Skoči na glavni sadržaj

Izvorni znanstveni članak

https://doi.org/10.17113/ftb.61.02.23.7929

The Occurrence of Folate Biosynthesis Genes in Lactic Acid Bacteria from Different Sources

Fenny Amilia Mahara orcid id orcid.org/0000-0002-0078-3397 ; Department of Food Science and Technology, Faculty of Agricultural Engineering, and Technology, IPB University (Bogor Agricultural University), 16680 Bogor, Indonesia
Lilis Nuraida orcid id orcid.org/0000-0002-0847-5786 ; Department of Food Science and Technology, Faculty of Agricultural Engineering, and Technology, IPB University (Bogor Agricultural University), 16680 Bogor, Indonesia
Hanifah Nuryani Lioe orcid id orcid.org/0000-0003-1364-0798 ; Department of Food Science and Technology, Faculty of Agricultural Engineering, and Technology, IPB University (Bogor Agricultural University), 16680 Bogor, Indonesia
Siti Nurjanah orcid id orcid.org/0000-0002-3275-9404 ; Department of Food Science and Technology, Faculty of Agricultural Engineering, and Technology, IPB University (Bogor Agricultural University), 16680 Bogor, Indonesia


Puni tekst: engleski pdf 1.395 Kb

str. 226-237

preuzimanja: 514

citiraj

Preuzmi JATS datoteku

Prilozi: FTB-61-226-S1.pdf


Sažetak

Research background. Lactic acid bacteria (LAB) are known to produce folate. However, this ability is highly strain-dependent. Folate synthesis in specific LAB strains is affected by the availability of folate, which can be consumed by other LAB under certain conditions. Moreover, differences in folate synthesis capabilities are related to the presence of folate biosynthesis-related genes and regulation of this pathway.
Experimental approach. As basic information to better understand the regulation of folate biosynthesis among different LAB species and strains, folate biosynthetic genes were screened and identified in folate-producing and non-folate-producing LAB isolated from various local food sources in Indonesia. The extracellular folate productivity amounts of the isolates were analyzed using high-performance liquid chromatography with a diode array detector (HPLC-DAD).
Results and conclusions. Eleven of the thirteen tested LAB isolates had all of the eight genes involved in folate biosynthesis (folE, folQ, folB, folK, folP, folC1, folA and folC2). Furthermore, these isolates produced extracellular folate ranging from 10.37 to 31.10 µg/mL. In contrast, two non-folate-producing isolates lacked several folate biosynthetic genes, such as folQ, folP and folA, which is possibly the reason for their inability to synthesize folate de novo. Phylogenetic tree construction revealed that the folate biosynthetic genes (excluding folK and folP) from six distinct species of folate-producing LAB isolates were monophyletic with homologous genes from other LAB species in the database.
Novelty and scientific contribution. In this study, the distribution of folate biosynthetic genes in various LAB species was determined. The findings from this research support the use of folate biosynthesis marker genes in the genotypic screening for folate-producing LAB.

Ključne riječi

extracellular folate producer; folate biosynthetic genes; lactic acid bacteria

Hrčak ID:

305968

URI

https://hrcak.srce.hr/305968

Datum izdavanja:

29.6.2023.

Podaci na drugim jezicima: hrvatski

Posjeta: 2.388 *




INTRODUCTION

Folate is a micronutrient required for growth, particularly during foetal development. Deficiency in this vitamin can lead to various disorders, such as megaloblastic anaemia, neural tube defects, coronary heart disease, and cancer risk (1). Thus, folate supplementation is one of the world's primary nutritional goals, especially in pregnant women (2,3).

Recently, folate-producing microorganisms have been increasingly used to produce natural folate-rich food products (4). In addition to a variety of green plants (5), folate can be synthesized by certain microbes, such as lactic acid bacteria (LAB) (6–9). Microorganism-produced folate is more available for absorption by the human body and, hence, more effective in providing folate needs (10,11).

Nevertheless, the capacity of LAB to synthesize folate is highly strain-dependent (7,9,12). Various attempts have been made to select superior folate producers by exploiting diverse food sources (7,8,13–15). Growth optimization is also frequently implemented to boost folate production (11,16,17). However, the presence of folate in the media can affect the bacterial ability to produce it, with some folate-producing strains consuming the available folate in the media rather than resynthesizing it (18). This might be due to the efficient metabolic regulation in microbes (19), and possibly the presence of feedback inhibition mechanisms in the regulation of folate biosynthesis (20,21). Consequently, folate in the media may inhibit or inactivate several enzymes involved in folate biosynthesis (18).

Folate biosynthesis requires three main building blocks, namely: (i) the pteridine moiety (6-hydroxymethyl-7,8-dihydropterin pyrophosphate (DHPPP)), (ii) 4-aminobenzoic acid (p-aminobenzoic acid or PABA), and (iii) glutamate. Most LAB cannot synthesize PABA and glutamate (12,22), which need to be supplied in the medium. Hence, the folate biosynthetic pathway can be divided into two phases, i.e. the formation of the pteridine moiety (DHPPP) and the combination of the three constituents of folate.

Eight folate biosynthetic enzymes are involved in the conversion of the guanosine triphosphate (GTP) precursor into tetrahydrofolate (THF) polyglutamate. Initially, GTP cyclohydrolase I (encoded by the folE gene) catalyzes the conversion of GTP to 7,8-dihydroneopterin triphosphate. Enzyme dITP/XTP pyrophosphatase (encoded by the folQ gene) hydrolyzes dihydroneopterin triphosphate to dihydroneopterin monophosphate, which is then hydrolyzed further to dihydroneopterin by a specific phosphatase. The biosynthetic pathway continues with the conversion of dihydroneopterin to 6-hydroxymethyl-7,8-dihydropterin by dihydroneopterin aldolase, encoded by the folB gene, and further converted to DHPPP by hydroxymethyl dihydropterin pyrophosphokinase (HPPK), encoded by folK. DHPPP and PABA are transformed into dihydropteroate by dihydropteroate synthase (DHPS), encoded by folP, and then conjugated with glutamate to become dihydrofolate by dihydrofolate synthase (encoded by folC1). Dihydrofolate is an inactive form of folate; thus, it must be reduced by dihydrofolate reductase (encoded by folA) into the active form, tetrahydrofolate (THF). The newly synthesized THF is in the monoglutamate form, hence, requiring the activity of folylpolyglutamate synthase (encoded by folC2) to add multiple glutamate residues to form THF polyglutamate.

In silico research by de Crécy-Lagard et al. (23) showed that two folate biosynthetic genes, folK (encoding HPPK enzyme) and folP (encoding DHPS enzyme), can be used as signature genes of folate biosynthesis. The proteins encoded by these two genes were found in all folate-producing bacteria in an investigation of nearly 400 bacterial genome sequences. Turpin et al. (24) also performed molecular screening of the two signature genes on 152 strains of six distinct LAB species. They found that 98 % of the isolates (150 strains) possessed these two genes, implying that these isolates could produce folate. However, Greppi et al. (9) discovered that despite having both hallmark genes, 56 of these isolates could not synthesize folate and instead consumed folate in the medium. Therefore, the detection of folK and folP genes is insufficient to determine folate production capability in LAB.

This research aims to determine the occurrence of genes encoding folate biosynthetic enzymes in various folate-producing and folate-consuming LAB species isolated from diverse local food sources in Indonesia. Results of the distribution of folate biosynthetic genes in distinct LAB species in this study can be useful in understanding variations in the regulation of folate biosynthesis across different LAB species and strains.

MATERIALS AND METHODS

LAB isolates and growth conditions

The LAB isolates used in this study (Table 1 (18,25)) were taken from the culture collections of the SEAFAST Center, IPB University, Bogor, Indonesia. These isolates exhibited varying growth abilities in folate-free media (18). Lactiplantibacillus plantarum WCFS1 was used as a positive control for folate gene detection because all folate biosynthesis genes are present in its genome (24–26). All LAB isolates were stored in a mixture of de Man, Rogosa and Sharpe broth (MRSB; CM0359, Oxoid Ltd., Basingstoke, UK) and 20 % glycerol at −20 °C and revived in MRSB before use.

Table 1 Lactic acid bacteria used in this study
NoIsolateSourceGenBank accession no.Reference
1Lactiplantibacillus plantarum WCFS1Human salivaNC_004567.2 (25)
2Lactiplantibacillus plantarum 4C261Salted mustardOM980095 (18)
3Lactiplantibacillus plantarum R12Breast milkMG952229 (18)
4Limosilactobacillus fermentum JK13Kefir granulesON005305.1 (18)
5Limosilactobacillus fermentum JK16Kefir granulesON025957.1 (18)
6Limosilactobacillus fermentum BK27Sticky rice tapaiMG934339 (18)
7Limosilactobacillus fermentum BG7Kefir granulesON005183 (18)
8Lacticaseibacillus rhamnosus R23Breast milkMF689061 (18)
9Lacticaseibacillus rhamnosus R15Breast milkMF689049 (18)
10Lacticaseibacillus rhamnosus BD2Kefir granulesMT020089.1 (18)
11Pediococcus acidilactici NG64Cassava tapaiMG928526 (18)
12Leuconostoc mesenteroides S2SR08TempeMF164053 (18)
13Lactobacillus kefiri JK6Kefir granulesMT613694.1 (18)
14Lactobacillus kefiri BG8Kefir granulesMT613703.1 (18)

DNA extraction

Each pure culture was grown for 18 h in MRSB supplemented with 10 % glycine. Genomic DNA was extracted from bacterial cell pellets using the Wizard® Genomic DNA Purification Kit (A1120; Promega Corporation, Madison, WI, USA), following the manufacturer's instructions (27). The purity and concentration of the extracted DNA were determined using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The DNA samples were then stored at −20 °C.

Primer design

The presence of eight genes involved in the folate biosynthesis pathway was detected in various LAB species by polymerase chain reaction (PCR) amplification. The primers for the detection and sequencing of each gene are shown inTable 2 (24). Six of these genes were designed using the online tool NCBI Primer-BLAST (the Basic Local Alignment Search Tool) (28) and gene sequences of Lactiplantibacillus plantarum WCFS1 obtained from the Kyoto Encyclopedia of Genes and Genomes (KEGG) (26) and GenBank (29) databases. All primers were manufactured by Integrated DNA Technologies Pte. Ltd. (Coralville, IA, USA).

Table 2 List of primers used for the gene detection and sequencing analysis in this study
Targeted geneEnzymeSequence (5′– 3′)Primer length/baseAmplicon size/bpw(GC)/%Melting temperature/°CReference
folKHydroxymethyl dihydropteridine pyrophosphokinase (EC 2.7.6.3)F: CCATTTCCAGGTGGGGAATC2021455.055.8 (24)
R: GGGGTGGTCCAAGCAAACTT2055.058.2
folPDihydropteroate synthase (EC 2.5.1.15)F: CCASGRCSGCTTGCATGAC1926165.860.8 (24)
R: TKACGCCGGACTCCTTTTWY2050.055.8
folQDihydroneopterin triphosphate pyrophosphohydrolase (EC 3.6.1.-)F: GGCTTGACTGCTCGTCAGTA2021455.056.9*designed in this study
R: TGACTGCAACCCCTAAGTCG2055.057.0
folEGTP cyclohydrolase I (EC 3.5.4.16)F: CGGGTTGCACGAATGTATGC2027255.057.1*designed in this study
R: ACTGTCAACCGCTCCTGAAC2055.057.4
folADihydrofolate reductase (EC 1.5.1.3)F: GACATGCAGCGGTTCAAAGC2036255.057.5*designed in this study
R: ACCGTCCCAATTTGTTGGCT2050.057.7
folBDihydroneopterin aldolase (EC 4.1.2.25)F: GGAAGAACGGCGTAATGGTC2026355.056.0*designed in this study
R: TTCCAGGCATTGGTACGCTA2050.056.3
folC1Dihydrofolate synthase (EC 6.3.2.12)F: AGTGAGCGATTTGGACAGCA2033150.057.0*designed in this study
R: AGTCGCTGCCATCCTTGAAA2050.057.1
folC2Folylpolyglutamate synthase (EC 6.3.2.17)F: GGCTGTTTTGCAGACCGAAG2048755.057.0*designed in this study
R: TGCGGGCGTATTCGTAATCA2050.056.7

GC=guanine-cytosine

Polymerase chain reaction amplification for the gene detection

PCR amplifications were performed in 20 µL volumes with 10 µL Promega Go Taq Green Master Mix 1× (M7122; Promega Corporation), containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers, 1 µL of 0.5 µM of each forward and reverse primer, 1 µL DNA template (>150 ng) and 7 µL nuclease-free water (NFW P1193; Promega Corporation). The amplifications were carried out using an Applied Biosystems 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) with the following cycling conditions: 1 cycle at 95 °C for 2 min; 30–35 cycles at 95 °C for 30 s, the annealing temperature depending on the melting temperature of each primer and tested at 50–60 °C for 1 min, and at 72 °C for 30 s; and 1 cycle at 72 °C for 5 min. The positive and negative controls were also subjected to amplification. The positive control was DNA from the reference strain (L. plantarum WCFS1), while the negative control was NFW without DNA containing the target genes. The PCR products were then separated by gel electrophoresis (Mini-Sub Cell GT Horizontal Electrophoresis System; BioRad Laboratories Inc., Hercules, CA, USA) using 2 % agarose gel in 1× Tris-acetate-EDTA (TAE) buffer and visualized using ethidium bromide staining.

Sequencing analysis

The detected folate biosynthetic genes in six folate-producing isolates of different species, represented by Lactiplantibacillus plantarum 4C261, Lacticaseibacillus rhamnosus R23, Limosilactobacillus fermentum JK13 and BG7, Pediococcus acidilactici NG64, and Leuconostoc mesenteroides S2SR08, were sequenced by 1st Base Sequencing (Selangor, Malaysia) using the Sanger method (Sanger dideoxy sequencing) (30) after purification. A single sample of purified DNA for each folate gene was needed as a template for sequencing. The PCR products with more than one band on agarose gel electrophoresis were first cut out of the gel and purified using a DNA gel extraction kit (GeneJET Gel Extraction Kit; Thermo Fisher Scientific Inc.). Samples with a single DNA band of the expected size on agarose gel electrophoresis were purified further before sequencing. The PCR cleanup step was then performed by an ultrafiltration method using Centricon-100 micro-concentrator columns (Applied Biosystems) to remove unincorporated primers and dNTPs that can interfere with the sequencing results. DNA quality and quantity were then determined by agarose gel electrophoresis and spectrophotometry. After DNA template preparation, cycle sequencing was performed using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and run in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems). The excess dye terminator was removed by spin column purification with Centri-Sep spin columns (Applied Biosystems) prior to analysis on an ABI PRISM 3730xl genetic analyzer (Applied Biosystems). The primers used for sequencing were those listed inTable 2 (the same primers for gene detection). The sequencing output was then analyzed using Sequence Scanner Software v. 2.0 (Applied Biosystems) (31).

The sequenced nucleotides were processed using MEGA7: Molecular Evolutionary Genetic Analysis v. 7.0 (32). The obtained consensus DNA sequences (contigs) were used as the query sequences to perform homology searches using the NCBI BLAST algorithm (28). The 'blastn' program was used to find areas of local similarity between query and database nucleotides. The identified query sequences were then stored in the GenBank database with the accession numbers shown inTable 3 (29).

Table 3 GenBank (29) accession numbers of each gene
GeneGenBank accession no.
4C261R23JK13BG7S2SR08NG64
folEOP067669OP067670OP067671OP067672OP067673OP067674
folQON972433ON986778ON972435ON972434ON986777ON972436
folBOP032089OP032086OP032085OP032088OP032084OP032087
folKOP032090OP032091OP032092OP032093OP032094OP032095
folPOP067663OP067664OP067665OP067666OP067667OP067668
folC1OP081807OP081808OP081809OP081810OP081811OP081812
folAON950739ON972429ON972430ON972428ON972432ON972431
folC2OP067675OP067676OP067677OP067678OP067679OP081806

Phylogenetic tree construction

Due to the inadequacy of the folate biosynthesis gene database in NCBI GenBank (29), the KEGG (26) was used as a primary reference for nucleotide sequence database for each folate biosynthetic gene. The MEGA v. 7.0 software (32) was used to align folate-related gene sequences from six isolates and reference data by the ClustalW program (incorporated in the MEGA software). The same software was also used to create phylogenetic trees using the neighbor-joining method and Jukes and Cantor models for determining evolutionary distance values with a 1000 replicate bootstrap test.

Extracellular folate production in folate-free medium

The inoculum of all LAB isolates was prepared according to a previously described method (18). Bacterial cell pellets grown for 24 h in MRSB were washed twice by centrifugation (refrigerated centrifuge LRF-B20; Labtron Equipment Ltd., Camberley, UK) at 10 000×g for 5 min at 4 °C and finally resuspended in sterile saline solution (0.85 % m/V NaCl; Merck KGaA, Darmstadt, Germany). The bacterial suspensions had cell densities of around 9–10 log colony-forming units (CFU)/mL, which were diluted to 5–6 log CFU/mL before use as inoculum. A total of 2 % inoculum was then grown in folate-free medium (folic acid casei medium, FACM; HiMedia Laboratories, Mumbai, India) at 37 °C for 24 h and subcultured twice in the same medium under the same growth conditions. The extracellular folate was extracted by centrifugation (refrigerated centrifuge LRF-B20; Labtron Equipment Ltd.) at 10 000×g for 5 min, followed by supernatant filtration using a 0.2-μm nylon filter membrane (ANPEL Laboratory Technologies Inc., Shanghai, PR China). All samples were then stored at –20 °C until further analysis.

Extracellular folate analysis with HPLC

Extracellular folate was analyzed using an Agilent 1260 Infinity HPLC System with a diode array detector (DAD; Agilent Technologies Inc., Santa Clara, CA, USA) and a ZORBAX Eclipse XDB-C18 chromatography column (15 cm×4.6 mm, 5 μm; Agilent Technologies, Inc.) at λ=282 nm. The mobile phase was freshly prepared and consisted of water (HPLC grade; LiChrosolv®, Merck KGaA) with glacial acetic acid (0.66 %; EMSURE®, Merck KGaA) and methanol (pure HPLC grade; LiChrosolv®, Merck KGaA), with a ratio of V(water):V(methanol)=70:30 (33). The flow rate was 0.8 mL/min. Folic acid standard was obtained from R-Biopharm (provided in the Vitafast folic acid test kit; Pfungstadt, Germany) and used without further purification.

Data analysis

The data were analyzed using SPSS v. 20.0 (34), with the statistical significance level set at 95 % (α<0.05). A one-way ANOVA was used to compare the differences in the extracellular folate productivity of the isolates in folate-free culture medium (FACM).

RESULTS AND DISCUSSION

Detection of folate biosynthesis genes

Eight folate biosynthetic genes (folE, folQ, folB and folK in the DHPPP formation pathway, and folP, folC1, folA and folC2 in the THF-polyglutamate formation pathway) were successfully amplified using gene-specific primers, with the predicted size of the PCR amplicon for each gene (Fig. 1). As a positive control, a single band for each of the eight genes was also detected in Lactobacillus plantarum WCFS1. No bands were detected in the negative control (data not shown).

Fig. 1 Detection of folate biosynthetic genes: a) folE, b) folQ, c) folB, d) folK, e) folP, f) folC1, g) folA, and h) folC2, by gel electrophoresis in 14 isolates of lactic acid bacteria. Lane 1: Lactiplantibacillus plantarum WCFS1, lane 2: L. plantarum 4C261, lane 3: L. plantarum R12, lane 4: Lacticaseibacillus rhamnosus R23, lane 5: L. rhamnosus R15, lane 6: L. rhamnosus BD2, lane 7: Limosilactobacillus fermentum JK13, lane 8: L. fermentum JK16, lane 9: L. fermentum BK27, lane 10: L. fermentum BG7, lane 11: Leuconostoc mesenteroides S2SR08, lane 12: Pediococcus acidilactici NG64, lane 13: Lactobacillus kefiri JK6, and lane 14: L. kefiri BG8
FTB-61-226-f1

However, despite designing specific primers and performing amplifications at various annealing temperatures, non-specific detections, seen as a double band or multiple bands on gel electrophoresis, were observed. In seven of the 11 folate-producing isolates, i.e. Lactobacillus rhamnosus R23 and R15, L. fermentum JK13, L. plantarum 4C261, R12 and JK16, and Pediococcus acidilactici NG64 (18), all folate biosynthetic genes were specifically detected. In the other folate-producing isolates, there were non-specific detections of one gene, i.e. L. fermentum BK27 (folB), L. fermentum BG7 (folB), Leuconostoc mesenteroides S2SR08 (folC1) and L. rhamnosus BD2 (folP). Non-specific detection of genes was previously reported by Saubade et al. (35), where the folP gene was detected in several pearl-millet-based porridge samples by more than one band on gel electrophoresis. The report also suggested that both specific and non-specific detections were thought to indicate the presence of a gene.

Two isolates, JK6 and BG8, are known folate non-producers (18) and did not have a complete set of folate biosynthesis genes, possibly leading to their inability to produce folate. The JK6 isolate lacked the folQ gene, while the BG8 isolate lacked folQ, folP and folA, as indicated by the absence of the corresponding bands after gel electrophoresis (Fig. 1b,Fig. 1e andFig. 1g). However, the two non-folate-producing isolates still have folK, one of the signature genes for folate biosynthesis, and even the JK6 isolate has both signature genes, folK and folP. This finding is supported by Greppi et al. (9), who reported that some LAB isolates could not synthesize folate despite having the signature genes folP and folK. Other folate biosynthetic genes probably play an essential role in determining the LAB folate production capacity.

Tetrahydrofolate, whose production is regulated by folP, folC1, folA and folC2, acts as a cofactor in one-carbon metabolic reactions in various pathways, such as the biosynthesis of purines, thymidine, glycine, methionine, pantothenate and formyl-methionyl tRNA (fMet-tRNA), which is required for the initiation of protein synthesis (23,36–39). These folate-dependent metabolites, except fMet-tRNA, can be provided in bacterial growth media. Thus, THF is essential for the production of fMet-tRNA, which is needed for the growth of folate-requiring bacteria. In the final stage of the THF biosynthetic pathway, the reduction of dihydrofolate to THF is catalyzed by dihydrofolate reductase (DHFR), encoded by the folA gene. In addition, when bacteria require a folate supply from the environment, the conversion of folic acid to dihydrofolate in the folate salvage pathway also involves the activity of the DHFR enzyme (23). For this reason, all folate-dependent bacteria need a minimum amount of DHFR activity to synthesize fMet-tRNA. Thus, DHFR is expected to be found in both folate producers and non-producers (23,40).

However, not all LAB isolates in our investigation had the folA gene. The BG8 isolate, a non-producer of folate, lacked this gene. Levin et al. (41) also stated that although THF is an essential cofactor for all bacteria, the gene encoding DHFR cannot be found in many bacteria. The unavailability of the folA gene in these bacteria may be due to the presence of another type of DHFR enzyme encoded by another gene. Work by de Crécy-Lagard et al. (23) showed that some bacteria might have different types of DHFR, such as DHFR1 (encoded by folM), belonging to the short-chain dehydrogenase/reductase family, or DHFR2, a flavin-dependent dihydropteroate reductase fused with DHFR. Hence, the BG8 isolate is predicted to also have the folM gene or the gene encoding DHFR2, as a homologous gene of folA.

In the folate biosynthetic pathway, the formation of THF-polyglutamate is crucial for folate retention in bacterial cells and is required for most folate-dependent enzymes which have a higher affinity for polyglutamate folate (6,42,43). The conversion of THF monoglutamate into the polyglutamate form is catalyzed by folylpolyglutamate synthase (FPGS), encoded by the folC2 gene. Therefore, in addition to folA, folC2 should also be found in all folate-dependent bacteria. Furthermore, FPGS is essential for folate-consuming bacteria, as they can only sequester monoglutamate folate (1-3 glutamate residues) via the salvage route due to the lack of an enzyme to break down folate polyglutamate (γ-glutamyl hydrolase) (20,44,45). However, in some bacteria, the folC2 gene can be found in the fusion gene of folC, encoding the bifunctional enzymes DHFS and FPGS. Non-folate-producing bacteria lacking either the folC2 or folC genes may harbour a gene encoding a novel type of FPGS. According to de Crecy-Lagard et al. (23), the unavailability of the folC gene in Mycoplasma species relying on the salvage pathway may be due to the presence of another gene encoding a different FPGS. In this study, folC2 was detected in all LAB isolates (producers and non-producers of folate).

Since all folate-dependent bacteria have the genes folA and folC2 (or folC), or their homologues (23,40), folate biosynthetic genes defining the potential ability of LAB to synthesize folate may include genes folE, folQ, folB and folK, involved in the DHPPP biosynthetic pathway, and the folP gene, involved in THF-polyglutamate biosynthesis. Rossi et al. (12) also reported that the genes folC (folC1/folC2) and folA, or their homologues, were found in all studied LAB species, whereas other folate biosynthetic genes were detected only in a few species.

In this study, the JK6 and BG8 isolates lacked the gene folQ, which encodes dihydroneopterin triphosphate pyrophosphohydrolase. In some folate-producing bacteria (such as Bacillus subtilis, Escherichia coli and Streptococcus thermophilus), the absence of the folQ gene may be due to the presence of other homologous genes that have not been identified (25). However, as JK6 and BG8 isolates could not grow in a folate-free medium (FACM), the missing folQ gene in both isolates may indicate that the gene folQ can be a limiting factor in their ability to synthesize folate. Moreover, Liu et al. (46) have reported that in the DHPPP biosynthetic pathway, the folQ gene had the highest expression level, demonstrating a better folate synthesis ability in L. plantarum strain 4_3 used in their study. Although further research of gene expression level analysis is also required in this study, the present findings suggest that the folQ gene may play a crucial role in determining the potential ability of LAB to synthesize folate.

Here, the detection of folate biosynthetic genes did not include the detection of genes encoding PABA biosynthetic enzymes (pabA and pabB/pabC) due to the lack of these genes in almost all lactobacilli, as reported by Rossi et al. (12). Thus, lactobacilli are generally unable to produce folate without PABA supplementation in the medium (9,12). The FACM used in this study has neither folate nor glutamic acid but it still contains 2 mg/L of PABA (based on the technical datasheet). Despite the presence of PABA in the FACM, the JK6 and BG8 isolates were unable to grow in this medium, indicating that both could not utilize PABA as a precursor in the medium to carry out folate biosynthesis in their cells. Hence, the availability of PABA biosynthetic genes can be neglected in this case.

Phylogenetic analyses

The sequences of eight folate biosynthetic genes (folE, folQ, folB, folK, folP, folC1, folA and folC2) from six folate-producing LAB isolates (R23, 4C261, JK13, BG7, S2SR08 and NG64) (using the same primer for gene detection) yielded different contig sizes for each isolate (Table S1). Nucleotide BLAST search revealed that all the folate genes are homologous with the LAB genome (instead of specific genes for folate biosynthesis) in the NCBI database with 100 % nucleotide sequence identity (Table S2). Hence, the references of nucleotide sequences for each folate biosynthetic gene from KEGG database were used to construct the phylogenetic trees shown inFig. 2 andFig. 3. The phylogenetic tree analyses showed that the six folate genes (folE, folQ, folB, folA, folC1 and folC2) found in folate-producing isolates are from the monophyletic group of LAB species in the database, including the positive control, L. plantarum WCFS1 (Figs. 2a-2c andFigs. 3b-3d). For the two other genes, folK and folP, only isolate R23 has both genes from the monophyletic group of LAB species in the database, while the other five folate-producing isolates have the genes from the polyphyletic group (Fig. 2d andFig. 3a).

Fig. 2 Phylogenetic analyses of: a) folE, b) folQ, c) folB, and d) folK genes involved in the 6-hydroxymethyl-7,8-dihydropterin pyrophosphate (DHPPP) biosynthesis pathway by 6 folate-producing lactic acid bacteria (LAB). The phylogenetic trees were constructed using the Jukes and Cantor model and the neighbor-joining method included in MEGA v. 7 software (32). Bootstrap values (based on 1000 replicates) that are greater than 50 % are indicated at the nodes
FTB-61-226-f2
Fig. 3 Phylogenetic analyses of: a) folP, b) folC1, c) folA, and d) folC2 genes involved in the tetrahydrofolate (THF)-polyglutamate biosynthesis pathway by 6 folate-producing lactic acid bacteria (LAB). The phylogenetic trees were constructed using the Jukes and Cantor model and the neighbor-joining method included in MEGA v. 7 software (32). Bootstrap values (based on 1000 replicates) that are greater than 50 % are indicated at the nodes
FTB-61-226-f3

L. plantarum WCFS1 was selected as a reference strain to compare the similarity of the folate genes from the six isolates because it possesses a complete set of folate biosynthetic genes and has been well studied for its capacity to produce folate (9,24–26). The comparison of the number of conserved sites (C) and variable sites (V) of eight folate biosynthetic genes among the six folate-producing LAB isolates and the reference strain (L. plantarum WCFS1) is given inTable S3. A higher percentage of conserved sites was found in six folate genes that are monophyletic with L. plantarum WCFS1, ranging from 66 to 86 % for folE, 47–96 % for folQ, 96–98 % for folB, 95 % for folC1, 66–97 % for folA, and 92–96 % for folC2. Only 0–2 % of sites were variable sites and the rest were gaps. Meanwhile, the two folate genes (folK and folP) of five isolates that are polyphyletic with L. plantarum WCFS1 showed fewer conserved sites (21–30 % for folK and 20–23 % for folP) than the variable sites (33–53 % for folK and 39–54 % for folP). As an exception, R23 had a higher proportion of conserved sites for both genes, as it is monophyletic with WCFS1.

Six folate-producing LAB isolates have the genetic capacity for de novo folate biosynthesis. The R23 isolate had all homologous folate genes that were the same as the positive control, L. plantarum WCFS1. The nucleotide sequences of the folK and folP genes of the five isolates showed remarkable differences from those of the positive control. The higher variable sites of folK and folP in five LAB isolates may indicate that both genes are not essential in the folate biosynthesis pathway. Jordan et al. (47) stated that essential genes are more conserved than nonessential genes in bacteria. The folK and folP genes of five isolates may contribute at different levels to de novo folate biosynthesis. However, more research is required to determine their correlation with folate production ability. The selection of folQ as a marker gene for folate biosynthesis in this study may also indicate that the folQ gene is essential in the folate biosynthesis pathway.

Based on the phylogenetic tree inFig. 2b, the gene folQ, which encodes the enzyme that catalyzes the conversion of dihydroneopterin triphosphate to dihydroneopterin monophosphate, is known to produce two isoforms, XTP/dITP diphosphatase (EC 3.6.1.66) and dihydroneopterin triphosphate diphosphatase (EC 3.6.1.67), that have the same function. Several LAB species from the KEGG database, such as Latilactobacillus sakei, L. kefiri and Lactococcus lactis, have the folQ gene encoding dihydroneopterin triphosphate diphosphatase (EC 3.6.1.67), while L. plantarum species has the folQ gene, which encodes for the XTP/dITP diphosphatase. These two types of enzymes were divided into two different clades (Fig. 2b). The folQ genes of six folate-producing LAB isolates (R23, 4C261, JK13, BG7, S2SR08 and NG64) in this study were in the same cluster as L. plantarum, indicating that the enzyme encoded by the folQ gene of the six isolates was probably the XTP/dITP diphosphatase.

Extracellular folate production

The concentration of folate produced by eleven LAB isolates (4C261, R12, R23, R15, BD2, JK13, JK16, BK27, BG7, S2SR08 and NG64) ranged from 10.37 to 31.10 μg/mL (Fig. 4a). The variability in the concentration of folate produced by these isolates was related to the availability of all eight genes involved in synthesizing folate (Fig. 4b). However, two isolates, JK6 and BG8, did not secrete extracellular folate (Fig. 4a) and did not have all the genes for folate biosynthesis (Fig. 4b). Five isolates (R23, JK13, BD2, R15 and NG64) had higher extracellular folate productivity, ranging from 18.40 to 31.10 μg/mL, than that of the positive control, L. plantarum WCFS1. The isolate L. rhamnosus R23 was the highest folate producer, producing 207 % more folate than WCFS1.

Fig. 4 Comparison of extracellular folate productivity and folate biosynthesis gene availability in 14 isolates of lactic acid bacteria (LAB). a) Extracellular folate productivity of 14 LAB isolates in folic acid casei medium (FACM) after 24 h of growth. The different letters (a-e) above the bars indicate significant differences between the means (p<0.05). b) Presence of folate biosynthetic genes in 14 LAB isolates. Arrow length represents gene length, on a scale of 0.1 cm=40 bp. DHPPP=6-hydroxymethyl-7,8-dihydropterin pyrophosphate, THF=tetrahydrofolate
FTB-61-226-f4

The folate concentrations measured in the isolates in this study were higher than those reported by Kodi et al. (33), who studied the LCF10 LAB strain isolated from fermented milk. Using the same analytical method employed here, they found that LCF10 produced 10.4 μg/mL folate in FACM after 18 h of incubation. Wu et al. (48) found higher folate production concentrations in L. casei, L. acidophilus and L. plantarum, which produced 45.41, 42.78 and 63.23 μg/mL of folate in yogurt products, respectively. Nevertheless, the highest folate concentration (31.10 μg/mL) produced by isolate R23 in this study is equivalent to ~8 % of the recommended daily folate intake, which is 400 μg per day for the average adult (49). Supplementation of food products with the R23 isolate can potentially be used as a good source of natural folate.

CONCLUSIONS

All eight folate biosynthetic genes were detected in eleven folate-producing LAB isolates. In the two non-folate-producing isolates, not all folate biosynthetic genes were present. The majority of the identified genes were homologous to genes encoding enzymes involved in the folate biosynthetic pathway, confirming the necessity of these genes in the LAB for folate production ability. The present study also suggests that molecular detection and identification is an excellent strategy for screening folate-producing LAB as an alternative to phenotypic analysis, which is quite time-consuming, laborious and costly. The folQ gene, which was not detected in non-folate-producing isolates, could potentially be used as a marker for folate biosynthesis.

Notes

[1] Financial disclosure FUNDING

This work was funded by the Ministry of Research, Technology and Higher Education of the Republic of Indonesia in the research scheme of Master of Education towards Doctoral Scholarship Program for Excellence Undergraduate (PMDSU), under contract no.: 3/E1/KP.PTNBH/2019.

[2] Conflicts of interest CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

SUPPLEMENTARY MATERIALS

Supplementary materials are available at:www.ftb.com.hr.

REFERENCES

1 

Warzyszynska JE, Kim YIJ. Folate in human health and disease. In: eLS. Chichester, UK: John Wiley & Sons, Ltd; 2014. pp. 1-14. https://doi.org/10.1002/9780470015902.a0002268.pub2 https://doi.org/10.1002/9780470015902.a0002268.pub2

2 

Gernand AD, Schulze KJ, Stewart CP, West KP, Christian P. Micronutrient deficiencies in pregnancy worldwide: Health effects and prevention. Nat Rev Endocrinol. 2016;12(5):274–89. https://doi.org/10.1038/nrendo.2016.37 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/27032981

3 

Rogers LM, Cordero AM, Pfeiffer CM, Hausman DB, Tsang BL, De‐Regil LM, et al. Global folate status in women of reproductive age: a systematic review with emphasis on methodological issues. Ann N Y Acad Sci. 2018;1431(1):35–57. https://doi.org/10.1111/nyas.13963 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30239016

4 

Mahara FA, Nuraida L, Lioe HN. Fermentation of milk using folate-producing lactic acid bacteria to increase natural folate content: A review. J Appl Biotechnol Rep. 2019;6(4):129–36. https://doi.org/10.29252/JABR.06.04.01

5 

Saini RK, Nile SH, Keum YS. Folate: Chemistry, analysis, occurrence, biofortification and bioavaibility. Food Res Int. 2016;89(Pt 1):1–13. https://doi.org/10.1016/j.foodres.2016.07.013 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28460896

6 

Sybesma W, Starrenburg M, Tijsseling L, Hoefnagel MHN, Hugenholtz J. Effects of cultivation conditions on folate production by lactic acid bacteria. Appl Environ Microbiol. 2003;69(8):4542–8. https://doi.org/10.1128/AEM.69.8.4542-4548.2003 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12902240

7 

Laiño JE, del Valle MJ, de Giori GS, LeBlanc JGJ. Applicability of a Lactobacillus amylovorus strain as co-culture for natural folate bio-enrichment of fermented milk. Int J Food Microbiol. 2014;191:10–6. https://doi.org/10.1016/j.ijfoodmicro.2014.08.031 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/25217720

8 

Salvucci E, LeBlanc JG, Pérez G. Technological properties of lactic acid bacteria isolated from raw cereal material. Lebensm Wiss Technol. 2016;70:185–91. https://doi.org/10.1016/j.lwt.2016.02.043

9 

Greppi A, Hemery Y, Berrazaga I, Almaksour Z, Humblot C. Ability of lactobacilli isolated from traditional cereal-based fermented food to produce folate in culture media under different growthconditions. Lebensm Wiss Technol. 2017;86:277–84. https://doi.org/10.1016/j.lwt.2017.08.007

10 

Lin MY, Young CM. Folate levels in cultures of lactic acid bacteria. Int Dairy J. 2000;10:409–13. https://doi.org/10.1016/S0958-6946(00)00056-X

11 

Divya JB, Nampoothiri KM. Folate fortification of skim milk by a probiotic Lactococcus lactis CM28 and evaluation of its stability in fermented milk on cold storage. J Food Sci Technol. 2015;52(6):3513–9. https://doi.org/10.1007/s13197-014-1406-7 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/26028733

12 

Rossi M, Amaretti A, Raimondi S. Folate production by probiotic bacteria. Nutrients. 2011;3:118–34. https://doi.org/10.3390/nu3010118 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22254078

13 

Dana MG, Salmanian AH, Yakhchali B, Jazi FR. High folate production by naturally occurring Lactobacillus sp. with probiotics potential isolated from dairy products in Ilam and Lorestan provinces of Iran. Afr J Biotechnol. 2010;9(33):5383–91.

14 

Mosso AL, Jimenez ME, Vignolo G, LeBlanc JG, Samman NC. Increasing the folate content of tuber based foods using potentially probiotic lactic acid bacteria. Food Res Int. 2018;109:168–74. https://doi.org/10.1016/j.foodres.2018.03.073 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/29803439

15 

Tarrah A, de Castilhos J, Rossi RC. Duarte VdS, Ziegler DR, Corich V, Giacomini A. In vitro probiotic potential and anti-cancer activity of newly isolated folate-producing Streptococcus thermophilus strains. Front Microbiol. 2018;9(2214):2214. https://doi.org/10.3389/fmicb.2018.02214 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30283428

16 

Nor NM, Mohamad R, Foo HL, Rahim RA. Improvement of folate biosynthesis by lactic acid bacteria using response surface methodology. Food Technol Biotechnol. 2010;48(2):243–50.

17 

Hugenschmidt S, Schwenninger SM, Lacroix C. Concurrent high production of natural folate and vitamin B12 using a co-culture process with Lactobacillus plantarum SM39 and Propionibacterium freudenreichii DF13. Process Biochem. 2011;46:1063–70. https://doi.org/10.1016/j.procbio.2011.01.021

18 

Mahara FA, Nuraida L, Lioe HN. Folate in milk fermented by lactic acid bacteria from different food sources. Prev Nutr Food Sci. 2021;26(2):230–40. https://doi.org/10.3746/pnf.2021.26.2.230 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/34316488

19 

Scott J, Rebeille F, Fletcher J. Folic acid and folates: The feasibility for nutritional enhancement in plant foods. J Sci Food Agric. 2000;80:795–824. https://doi.org/10.1002/(SICI)1097-0010(20000515)80:7<795::AID-JSFA599>3.0.CO;2-K

20 

Sybesma W, van den Born E, Starrenburg M, Mierau I, Kleerebezem M, de Vos WM, et al. Controlled modulation of folate polyglutamyl tail length by metabolic engineering of Lactococcus lactis. Appl Environ Microbiol. 2003;69:7101–7. https://doi.org/10.1128/AEM.69.12.7101-7107.2003 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/14660354

21 

Laiño JE, Levit R, de LeBlanc ADM, de Giori GS, LeBlanc JG. Characterization of folate production and probiotic potential of Streptococcus gallolyticus subsp. macedonicus CRL415. Food Microbiol. 2019;79:20–6. https://doi.org/10.1016/j.fm.2018.10.015 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30621871

22 

Lapujade P, Cocaign-Bousquet M, Loubiere P. Glutamate biosynthesis in Lactococcus lactis subsp. lactis NCDO 2118. Appl Environ Microbiol. 1998;64(7):2485–9. https://doi.org/10.1128/AEM.64.7.2485-2489.1998 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9647819

23 

de Crécy-Lagard V, El Yacoubi B, de la Garza RD, Noiriel A, Hanson AD. Comparative genomics of bacterial and plant folate synthesis and salvage: Predictions and validations. BMC Genomics. 2007;8(1):245. https://doi.org/10.1186/1471-2164-8-245 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17645794

24 

Turpin W, Humblot C, Guyot JP. Genetic screening of functional properties of lactic acid bacteria in a fermented pearl millet slurry and in the metagenome of fermented starchy foods. Appl Environ Microbiol. 2011;77(24):8722–34. https://doi.org/10.1128/AEM.05988-11 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22003019

25 

Wegkamp A. Modulation of folate production in lactic acid bacteria [PhD Thesis]. Wageningen, The Netherlands: Wageningen University; 2008.

26 

KEGG. Kyoto University, Japan: Kyoto Encyclopedia of Genes and Genomes; 1995. Available from:http://www.genome.jp/kegg/.

27 

28 

NCBI BLAST. Bethesda, MD, USA: National Center for Biotechnology Information, The Basic Local Alignment Search Tool, US National Library of Medicine; 2016. Available from:https://blast.ncbi.nlm.nih.gov/Blast.cgi.

29 

GenBank. Bethesda, MD, USA: National Center for Biotechnology Information, US National Library of Medicine; 2016. Available from:http://www.ncbi.nlm.nih.gov/genbank/.

30 

Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74(12):5463–7. https://doi.org/10.1073/pnas.74.12.5463 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/271968

31 

Sequence Scanner Software, v. 2.0, Applied Biosystems, Foster City, CA, USA; 2014. Available from:http://www.appliedbiosystems.com.

32 

Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–4. https://doi.org/10.1093/molbev/msw054 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/27004904

33 

Kodi C, Gothandam KM, Prabakaran G. Identification and characterization of folic acid producing potential starter for curd fermentation. Int J Curr Microbiol Appl Sci. 2015;4(6):118–30.

34 

Statistics SPSS. v. 20.0, IBM Corp, Armonk, NY, USA; 2011. Available from:https://www.ibm.com/analytics/spss-statistics-software.

35 

Saubade F, Humblot C, Hemery YM, Guyot JP. PCR screening of an African fermented pearl-millet porridge metagenome to investigate the nutritional potential of its microbiota. Int J Food Microbiol. 2017;244:103–10. https://doi.org/10.1016/j.ijfoodmicro.2016.12.020 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28092820

36 

Green JM, Matthews RG. Folate biosynthesis, reduction, and polyglutamylation and the interconversion of folate derivatives. Ecosal Plus. 2007;2(2):1–17. https://doi.org/10.1128/ecosalplus.3.6.3.6 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/26443588

37 

Shane B. Folate and vitamin B12 metabolism: overview and interaction with riboflavin, vitamin B6, and polymorphisms. Food Nutr Bull. 2008;29(2) Suppl:S5–16. https://doi.org/10.1177/15648265080292S103 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18709878

38 

Stover PJ. One-carbon metabolism–genome interactions in folate-associated pathologies. J Nutr. 2009;139(12):2402–5. https://doi.org/10.3945/jn.109.113670 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19812215

39 

Ohrvik VE, Witthoft CM. Human folate bioavailability. Nutrients. 2011;3:475–90. https://doi.org/10.3390/nu3040475 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22254106

40 

Myllykallio H, Leduc D, Filee J, Liebl U. Life without dihydrofolate reductase folA. Trends Microbiol. 2003;11(5):220–3. https://doi.org/10.1016/S0966-842X(03)00101-X PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12781525

41 

Levin I, Giladi M, Altman‐Price N, Ortenberg R, Mevarech M. An alternative pathway for reduced folate biosynthesis in bacteria and halophilic archaea. Mol Microbiol. 2004;54(5):1307–18. https://doi.org/10.1111/j.1365-2958.2004.04339.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15554970

42 

McGuire JJ, Bertino JR. Enzymatic synthesis and function of folylpolyglutamates. In: Najjar VA, editor. The biological effects of glutamic acid and its derivatives. Developments in molecular and cellular biochemistry, vol. 1. Dordrecht, The Netherlands: Springer; 1981. pp. 19-48. https://doi.org/10.1007/978-94-009-8027-3_2 https://doi.org/10.1007/978-94-009-8027-3_2

43 

Revuelta JL, Serrano-Amatriain C, Ledesma-Amaro R, Jiménez A. Formation of folates by microorganisms: towards the biotechnological production of this vitamin. Appl Microbiol Biotechnol. 2018;102(20):8613–20. https://doi.org/10.1007/s00253-018-9266-0 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30073396

44 

Tamura T, Shin YS, Williams MA, Stokstad ELR. Lactobacillus casei response to pteroylpolyglutamates. Anal Biochem. 1972;49(2):517–21. https://doi.org/10.1016/0003-2697(72)90456-3 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/4628358

45 

Shane B, Stokstad ER. Rate-limiting steps in folate metabolism by Lactobacillus casei. J Gen Microbiol. 1977;103(2):261–70. https://doi.org/10.1099/00221287-103-2-261 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/413875

46 

Liu CJ, Wu B, Zhang SY, Li QK, Zeng XQ, Yang E, et al. Transcriptomic analysis of de novo folate biosynthetic genes in Lactobacillus plantarum strain 4_3 in fermented soybean. Food Funct. 2019;10(5):2426–38. https://doi.org/10.1039/C8FO01952E PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30968106

47 

Jordan IK, Rogozin IB, Wolf YI, Koonin EV. Essential genes are more evolutionarily conserved than are nonessential genes in bacteria. Genome Res. 2002;12(6):962–8. https://doi.org/10.1101/gr.87702 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12045149

48 

Wu Z, Wu J, Cao P, Jin Y, Pan D, Zeng X, et al. Characterization of probiotic bacteria involved in fermented milk processing enriched with folic acid. J Dairy Sci. 2017;100(6):4223–9. https://doi.org/10.3168/jds.2017-12640 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28434721

49 

Human vitamin and mineral requirements: Report of a joint FAO/WHO expert consultation Bangkok, Thailand. Rome, Italy: Food and Agriculture Organization of the United Nations and World Health Organization (FAO/WHO); 2001. Available from:https://www.fao.org/3/y2809e/y2809e.pdf

Appendices

Table S1 Contig size of folate biosynthetic genes from six folate-producing lactic acid bacteria (LAB) isolates
IsolatefolEfolQfolBfolKfolPfolC1folAfolC2
R23273123265131163333273478
4C261271128265142194332364470
JK13209115257215185333248478
BG7274124265206185333260487
S2SR08274216265208194333364488
NG64273105257209233331272487
Table S2 Percent identity of folate biosynthetic genes from six folate-producing lactic acid bacteria (LAB) with nucleotide sequences from various LAB species in the NCBI databases (29)
GeneIsolateNCBI blastn
Identity/ %Description
folE4C261100L. plantarum strain SKO-001 chromosome, complete genome; ID: CP040374.1
R23100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
JK13100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
BG7100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
NG64100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
S2SR08100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
folQ4C261100L. plantarum strain SRCM102737 chromosome, complete genome; ID: CP028261.1
R23100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
JK13100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
BG7100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
NG64100L. plantarum strain SRCM103418 chromosome, complete genome; ID: CP035168.1
S2SR08100L. plantarum strain SRCM103418 chromosome, complete genome; ID: CP035168.1
folB4C261100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
R23100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
JK13100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
BG7100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
NG64100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
S2SR08100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
folK4C261100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
R23100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
JK13100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
BG7100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
NG64100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
S2SR08100L. fermentum strain LfQi6 chromosome; ID: CP025592.1
folP4C261100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
R23100L. fermentum strain HFD1 chromosome, complete genome; ID: CP050919.1
JK13100L. fermentum strain HFD1 chromosome, complete genome; ID: CP050919.1
BG7100L. fermentum strain HFD1 chromosome, complete genome; ID: CP050919.1
NG64100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
S2SR08100L. fermentum strain HFD1 chromosome, complete genome; ID: CP050919.1
folC14C261100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
R23100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
JK13100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
BG7100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
NG64100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
S2SR08100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
folA4C261100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
R23100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
JK13100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
BG7100L. plantarum strain TCI507 chromosome, complete genome; ID: CP054259.1
NG64100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
S2SR08100L. plantarum strain NCIMB8826 (WCFS1) chromosome, complete genome; ID: CP037961.1
folC24C261100L. plantarum strain LLY-606 chromosome, complete genome; ID: CP023306.1
R23100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
JK13100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
BG7100L. plantarum strain Heal19 chromosome, complete genome; ID: CP055123.1
NG64100L. plantarum strain SRCM100442 chromosome, complete genome; ID: CP028221.1
S2SR08100L. plantarum strain SRCM100442 chromosome, complete genome; ID: CP028221.1
Table S3 The comparison of the number of conserved sites (C) and variable sites (V) of eight folate biosynthetic genes between six folate-producing lactic acid bacteria (LAB) isolates and the reference strain (Lactiplantibacillus plantarum WCFS1)
IsolateReference strain (WCFS1)
folEfolQfolBfolKfolPfolC1folAfolC2
CVCVCVCVCVCVCVCV
R23271/3142/314123/2210/221263/2682/26872/25759/25792/30268/302327/3456/345272/3741/374478/5090/509
4C261269/3142/314127/2211/221263/2682/26853/25784/25759/302134/302327/3455/345361/3743/374469/5091/509
JK13209/3140/314115/2210/221256/2681/26876/257134/25765/302119/302327/3456/345247/3741/374478/5090/509
BG7271/3143/314124/2210/221263/2682/26873/257128/25765/302119/302327/3456/345259/3741/374487/5090/509
S2SR08271/3143/314212/2214/221263/2682/26873/257130/25767/302126/302327/3456/345362/3742/374484/5094/509
NG64271/3142/314104/2211/221256/2681/26874/257130/25770/302162/302327/3454/345272/3740/374483/5094/509

This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.