Skip to the main content

Original scientific paper

https://doi.org/10.2478/acph-2025-0034

Anticancer activity of Lavandula stoechas L. flower ethanolic extract through apoptotic pathway modulation in colorectal cancer cells

ZEYNEP DOĞRU orcid id orcid.org/0000-0001-7115-3360 ; Department of Basic Medical Sciences, Hamidiye Faculty of Dental Medicine, University of Health Sciences, Istanbul, Turkey
MUSTAFA SELIM DOĞRU orcid id orcid.org/0000-0002-7301-4038 ; Department of Pharmacy, Hamidiye Vocational School of Health Services, University of Health Sciences, Istanbul, Turkey *
GAMZE YEŞILAY orcid id orcid.org/0000-0002-3375-8956 ; Department of Molecular Biology and Genetics, Hamidiye Institute of Health Sciences, University of Health Sciences, Istanbul, Turkey
ÖZGECAN KAYALAR orcid id orcid.org/0000-0001-9107-2381 ; Department of Biology, Faculty of Arts and Sciences, Cukurova University, Adana, Turkey
MAHFUZ ELMASTAŞ orcid id orcid.org/0000-0002-1502-1141 ; Department of Biochemistry, Hamidiye Faculty of Pharmacy, University of Health Sciences, Istanbul, Turkey

* Corresponding author.


Full text: english pdf 1.623 Kb

page 449-468

downloads: 308

cite

Download JATS file


Abstract

This study aimed to investigate the anticancer effects and underlying mechanisms of an ethanolic extract of Lavandula stoechas L. flowers (LsHE) on colorectal cancer. The extract demonstrated high phenolic content (230.31 ± 11.28 mg GAE g–¹ dm) and strong antioxidant activity. HPLC analysis identified rosmarinic acid and quercetin as major constituents. HT-29 colorectal carcinoma cells and HEK-293 healthy kidney epithelial cells were treated with LsHE for 48 h. The concentration of LsHE required to inhibit 50 % of HT-29 cell viability was found to be 86.37 ± 3.07 µg mL–1, whereas a higher concentration of 131.30 ± 9.33 µg mL–1 was observed for HEK-293 cells. In HT-29 cells, flow cytometry analysis revealed increased early (9.7 %) and late (6.8 %) apoptotic populations following LsHE treatment (p < 0.0001). qRT-PCR analysis showed significant upregulation of TP53 and CASP3 compared to the untreated group (p < 0.05 and p < 0.01, resp.), while BAX expression was unexpectedly downregulated. These findings suggest that LsHE may trigger caspase-3-dependent apoptosis through a p53-mediated mechanism, potentially independent of the BAX/BCL-2 pathway. In conclusion, the present in vitro study highlights the potential of LsHE as a natural agent that still exerts some cytotoxicity toward normal epithelial cells and pro-apoptotic activity in colorectal cancer cells. Our findings provide a molecular basis for further in vivo studies to evaluate the possible therapeutic potential and mechanistic relevance of LsHE in CRC chemoprevention.

Keywords

Lavandula stoechas flowers; colorectal cancer; phenolic compounds; apoptosis; HT-29; TP53; CASP3

Hrčak ID:

335785

URI

https://hrcak.srce.hr/335785

Publication date:

30.9.2025.

Visits: 817 *




INTRODUCTION

Colorectal cancer (CRC) represents a major global health challenge, ranking as the third most frequently diagnosed malignancy and the second leading cause of cancer-related deaths worldwide. According to GLOBOCAN 2020 estimates, CRC accounts for approximately 10 % of new cancer cases and 9.4 % of cancer-related deaths annually (1). The progressive accumulation of genetic and epigenetic alterations in colonic epithelial cells contributes to malignant transformation and tumour progression (2). Numerous modifiable risk factors, including obesity, low physical activity, high consumption of red and processed meat, smoking, alcohol intake, and inflammatory bowel disease, have been linked to increased CRC risk (3–7). Despite advances in surgery, chemotherapy, immunotherapy and targeted therapies, colorectal cancer remains a major therapeutic challenge, particularly in advanced stages where treatment resistance and insufficient screening reduce overall efficacy (8–11). Resistance to chemotherapeutic agents and the inability to selectively target tumour cells remain major barriers to successful treatment, especially in metastatic CRC (12–14).

The increasing use of plant-derived compounds in both traditional and complementary medicine has drawn considerable scientific interest. In addition to their conventional use in primary healthcare, phytochemicals are gaining popularity in developed countries under the label of health supplements (15–17). These bioactive molecules exhibit chemopreventive properties through antioxidant activity, inhibition of inflammation, epigenetic regulation, and modulation of apoptosis-related signalling pathways (18–22).

Lavandula stoechas L. (Lamiaceae), commonly known as “karabaş otu” in Turkey, has been traditionally used in Mediterranean and Middle Eastern regions to alleviate respiratory and gastrointestinal ailments and is frequently consumed as an herbal infusion (23–26). Its therapeutic applications are thought to arise from its rich phytochemical composition, including rosmarinic acid, linalool and camphor, which exhibit documented antioxidant and anti-inflammatory activities (27). Recent studies have further demonstrated that L. stoechas extracts suppress cell proliferation and induce apoptosis in several cancer cell lines by modulating the expression of the BAX/BCL-2 signalling axis (28, 29). These findings highlight its emerging role as a candidate anticancer agent. However, despite such evidence, the molecular mechanisms underlying the effects of L. stoechas in colorectal cancer have not yet been clearly elucidated.

Dysregulation of the intrinsic apoptotic pathway, primarily involving the mitochondrial regulators BAX and BCL-2, the upstream tumour suppressor TP53, and the executioner enzyme caspase-3, contributes to colorectal tumorigenesis by impairing programmed cell death mechanisms (30). Given the central roles of these genes in CRC pathophysiology, targeting molecular pathways involving TP53, BAX, BCL-2, and CASP3 may provide a mechanistic rationale for the development of plant-derived anticancer therapeutics. Investigating the effects of natural compounds on the expression of these genes may offer new insights into potential therapeutic mechanisms. Despite its traditional use and reported pharmacological effects, there is currently limited evidence on the molecular mechanisms underlying the anticancer activity of L. stoechas, particularly in colorectal cancer. Therefore, this study aims to address this gap by evaluating its effects on key regulatory genes involved in inflammation and apoptosis.

The present study aims to evaluate the antiproliferative and pro-apoptotic potential of Lavandula stoechas L. flower ethanolic extract (LsHE) on HT-29 colorectal cancer cells, while also assessing cytotoxicity, apoptosis, and gene expression in both HT-29 and HEK-293 cells, as well as characterising the extract’s phenolic composition and antioxidant capacity.

EXPERIMENTAL

Cells and chemicals

The human cell lines, HT-29 colorectal cancer cells and HEK-293 healthy epithelial cells, were obtained from the American Type Culture Collection (ATCC, USA).

DMEM (Gibco, USA), fetal bovine serum (FBS), L-glutamine, penicillin-streptomycin, trypsin-EDTA, PBS and trypan blue (all from Merck KGaA, Germany) were used for cell culture. Alamar blue reagent was obtained from Invitrogen Life Technologies (USA). The cDNA synthesis kit was purchased from Nepenthe (Turkey), and SYBR green master mix was obtained from Roche (Germany). The FITC Annexin V apoptosis detection kit was obtained from Nepenthe. Gallic acid, 4-hydroxybenzoic acid, chlorogenic acid, vanillic acid, caffeic acid, epicatechin, p-coumaric acid, ferulic acid, salicylic acid, rutin hydrate, rosmarinic acid, apigenin-7-O-glucoside, cinnamic acid, quercetin, and naringenin (all HPLC grade, Merck) were used as standards. Methanol, ethanol, acetonitrile, and formic acid (all HPLC grade, Merck) were used for chromatographic analyses. Deionised water was prepared using a Milli-Q purification system (Merck).

Plant material and extract preparation

L. stoechas L. species were randomly collected from a field located at approximately 500 meters above sea level in Koçarlı district of Aydın province, Turkey, in June 2020. The botanical identification was performed, and the authenticated voucher specimens were deposited in the Herbarium of Istanbul University (voucher no. ISTE-118356).

The dried and vacuum-packed flowering tops of L. stoechas L. were ground using a laboratory-scale knife mill, operated intermittently to avoid overheating. The resulting powdered material was extracted at a ratio of 1:10 (m/V) in a 70:30 (V/V) ethanol-water mixture by maceration at 25 ± 2 °C for 24 hours. After filtration, the solvent was removed from the extract using a rotary evaporator (Heidolph Rotary Evaporator with WB eco bath, Germany). Afterwards, the extract was frozen at −80 °C and lyophilised (LaboGene ScanVac Coolsafe 110-4, Denmark) to obtain the crude extract. Prepared samples were stored at −18 °C until analysis. The extraction yield of LsHE was determined to be 12 % (m/m), based on the dry mass of the initial plant material. To ensure efficient extraction of phenolic compounds, an ethanol-water solvent system was employed, as such mixtures might enhance the yield of bioactive polyphenols compared to single-solvent extractions (31, 32).

Phytochemical characterization

Total phenolic contents . – The total phenolic content of the extract was determined using the colourimetric Folin-Ciocalteu method, which relies on the formation of blue-colored complexes between phenolic compounds and the Folin-Ciocalteu reagent in an alkaline medium, as described by Singleton and Rossi (33). Briefly, 0.5 mL of LsHE was mixed with 2.5 mL of Folin-Ciocalteu reagent (0.2 mol L–1, Merck), followed by the addition of 2.0 mL of sodium carbonate solution (75 g L⁻¹). The reaction mixture was incubated at room temperature for 2 hours in the dark. Absorbance was then measured at 765 nm using a UV-Vis spectrophotometer. The results were expressed as milligrams of gallic acid equivalents per gram of dry mass (dm) (mg GAE g–1).

Phenolic profile analyses. – The chromatographic method was adapted from previously validated literature sources (34, 35) and applied here for the phytochemical screening of LsHE. A quantitative analysis was performed using a Shimadzu Nexera-i LC-2040C 3D Plus high-performance liquid chromatography (HPLC) system. A photodiode array detector (PDA) set at 254 nm was used for detection. Chromatographic separation was performed using a phenylhexyl reversed-phase column (4.6 × 150 mm, 3 µm particle size; GL Sciences InterSustain, Japan). The mobile phase comprised solvent A: 0.1 % formic acid in deionised water, and solvent B: acetonitrile (HPLC grade), used in accordance with the gradient elution protocol outlined in Table SI (Supplementary material), adapted from previously validated methods (34, 35). The flow rate was sustained at 1.0 mL min–1, and the injection volume for both standards and samples was 10 µL. The column temperature was maintained at 30 °C during the study.

For each compound to be identified, the wavelength corresponding to maximum absorbance (λmax) was determined, and subsequent quantification was performed at the respective wavelength. Calibration curves were constructed for each standard compound (Table I).

Table I. HPLC data for reference standards

No.NameRetention time (min)λmax (nm) Standard calibration curve equation R 2 Limit of detection (LOD) (mg L–1)a
1 Gallic acid4.352271y = 29799.9x + 494.600.99950.74
2 4-Hydroxybenzoic acid10.217254y = 40036.7x + 238.330.99950.64
3 Chlorogenic acid12.073325y = 28066.0x + 5870.20.99901.37
4 Vanillic acid12.437260y = 48654.4x – 6981.10.99971.06
5 Caffeic acid12.850320y = 16914.9x – 409.460.99723.17
6 Epicatechin14.150277y = 4788.08x + 89.4570.99868.46
7 p-Coumaric acid18.486308y = 64013.4x –19190.20.99331.38
8 Ferulic acid20.971322y = 46665.0x –14606.20.99281.39
9 Salicylic acid21.929235y = 23472.2x + 25113.10.99944.69
10 Rutin23.494254y = 17392.1x –5957.130.99592.13
11 Rosmarinic acid26.857327y = 34304.9x –12772.00.99991.01
12 Apigenin-7-O-glucoside27.574336y = 39321.9x + 1685.180.99930.73
13 Cinnamic acid30.234276y = 75026.0x –11276.00.99880.68
14 Quercetin32.008254y = 26403.4x + 1558.710.99971.27
15 Naringenin34.939288y = 24207.0x + 2212.930.99201.31

aLOQ = 3×LOD

The analysis involved preparing the LsHE at a concentration of 1 mg mL–1 using the mobile phase, followed by analysis under the same chromatographic conditions (Table SI, Supplementary material). The concentrations of phenolic compounds detected in the extract are reported in mg mL–1 and, after calculation, given as mg g–1 extract. A representative chromatogram of 15 standard phenolic compounds used for calibration is shown in Fig. 1, where each peak corresponds to an individual compound detected at 254 nm.

image1.png

Fig. 1. HPLC chromatogram of a mixture of 15 standard phenolic compounds detected at 254 nm. Peaks were identified by comparing their retention times with those of reference standards: 1 – gallic acid, 2 – 4-hydroxybenzoic acid, 3 – chlorogenic acid, 4 – vanillic acid, 5 – caffeic acid, 6 – epicatechin, 7 – p-coumaric acid, 8 – ferulic acid, 9 – salicylic acid, 10 – rutin, 11 – rosmarinic acid, 12 – apigenin-7-O-glucoside, 13 – cinnamic acid, 14 – quercetin, 15 – naringenin.

In this report, only partial model re-validation of the already known HPLC-DAD method (34, 35) was performed (36–38).

Quantification was performed using calibration curves generated for each compound. Coefficient of determination (R²) for the calibration lines ranged from 0.9920 to 0.9999 (Table I). Limit of detection (LOD) and limit of quantification (LOQ) were calculated using the formulae LOD = 3.3σ/S and LOQ = 10σ/S, where σ represents the residual standard deviation of the regression line (based on five replicate measurements, n = 5) and S denotes the slope of the calibration curve.

Total antioxidant capacity. – The total antioxidant capacity (TAC) of L. stoechas L. extract was determined using the phosphomolybdenum method described by Prieto et al. (39). Briefly, 0.1 mL of the extract (1 mg mL–1) was mixed with 1.0 mL of the reagent solution containing 0.6 mol L–1 sulfuric acid, 28 mmol L⁻¹ sodium phosphate (Na2HPO4 × 12 H2O) and 4 mmol L⁻¹ ammonium molybdate, in a test tube. The mixture was incubated at 95 °C for 90 minutes in a thermal block. After cooling to room temperature, the absorbance was measured at 695 nm. TAC values were calculated based on an ascorbic acid calibration curve and expressed as milligrams of ascorbic acid equivalents per gram of dry mass (mg AAE g–1).

Cell culture, treatment and viability assay

HT-29 colorectal carcinoma and HEK-293 epithelial cells were cultured in DMEM supplemented with 10 % fetal bovine serum (FBS), 2 mmol L⁻¹ L-glutamine, and 1 % penicillin-streptomycin. Cells were incubated at 37 °C in a humidified atmosphere containing 5 % CO2. LsHE was dissolved in culture medium with 0.1 % (V/V) DMSO and applied to cells at concentrations ranging from 12.5 to 300 µg mL–1 for 48 hours. Cells were treated with Alamar blue reagent (10 % of the total well volume) for 3 hours, according to the manufacturer’s instructions, following 48-hour exposure to increasing concentrations of LsHE (12.5–300 µg mL–1). Absorbance was measured at 570 nm and 610 nm using a microplate reader. The concentration of LsHE required to inhibit 50 % of cell viability was determined by fitting non-linear sigmoidal dose–response curves to the viability data plotted against the log-transformed concentrations of LsHE.

Two types of control groups were included in all experiments: negative control - untreated cells, maintained under standard culture conditions without any treatment; vehicle control – cells exposed to culture medium containing 0.1 % (V/V) DMSO, corresponding to the solvent concentration used for LsHE dissolution.

Apoptosis assay

HT-29 and HEK-293 cells were treated with the concentration of LsHE required to inhibit 50 % of cell viability for 48 hours. Following treatment, cells were harvested using trypsin-EDTA, washed with phosphate-buffered saline (PBS), and stained with Annexin V-FITC and propidium iodide (PI) using the Annexin V-FITC/PI apoptosis detection kit (Nepenthe), according to the manufacturer’s instructions. After a 30-minute incubation at room temperature in the dark, apoptotic and necrotic cell populations were quantified by flow cytometry (CytoFLEX Flow Cytometer, Beckman Coulter, USA).

Gene expression analysis by qRT-PCR

Total RNA was extracted from HT-29 cells using the total RNA extraction kit (Nepenthe), according to the manufacturer’s protocol. RNA quantity and purity were evaluated with a NanoDropTM spectrophotometer (Thermo Scientific, USA), and samples with A260/280 ratios between 1.8 and 2.1 were used for downstream analyses.

cDNA was synthesised using the cDNA synthesis kit (Nepenthe), following the manufacturer’s instructions. The thermal conditions for reverse transcription were as follows: 25 °C for 5 minutes, 46 °C for 20 minutes, 95 °C for 1 minute, and held at 4 °C. Primer sequences for BAX, BCL-2, TP53, CASP3 and GAPDH are listed in Table II. GAPDH served as the reference gene.

Table II. Primer sequences used for qRT-PCR

GeneSequences (5’→3’)Annealing temp. (°C)
BAX

F: TCATGGGCTGGACATTGGAC

R: GCGTCCCAAAGTAGGAGAGG

60
BCL-2

F: CTTTGAGTTCGGTGGGGTCA

R: GGGCCGTACAGTTCCACAAA

60
TP53

F: TTTGAGGTGCGTGTTTGTGC

R: CCACGGATCTGAAGGGTGAA

60
CASP3

F: TCTGGTTTTCGGTGGGTGTG

R: TGGTTCCCGCAAAACTCACT

60
GAPDHF: ACCCACTCCTCCACCTTTGAC R: TGTTGCTGTAGCCAAATTCGTT60

qRT-PCR was performed using the QuantstudioTM 7 real-time PCR detection system (Thermo, USA). Each 10-μL reaction mixture contained 5 μL of SYBR Green master mix (Qiagen, Germany), 2 μL of diluted cDNA (10 ng µL–1), 1 μL of each primer mix (10 µmol L–1), and 2 μL of nuclease-free water. Thermal cycling conditions were as follows: initial activation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 5 s and combined annealing/extension at 60 °C for 10 s according to the manufacturer’s protocol. Primer specificity was verified by melting curve analysis. All reactions were performed in triplicate. Gene expression was analysed using the 2^–ΔΔCt method.

Statistical analysis

All experiments were conducted in triplicate, and data are expressed as mean ± standard deviation (SD). The Kruskal-Wallis test followed by Dunn’s post hoc test was used for multiple group comparisons, and the Mann-Whitney U test was used for pairwise comparisons. Analyses were performed using GraphPad Prism 5.0. A p-value lower than 0.05 was considered statistically significant.

RESULTS AND DISCUSSION

Phenolic compounds

Total phenolics. – The total phenolic content (TPC) of the LsHE, calculated from the gallic acid calibration curve (y = 0.0082x + 0.0208, R² = 0.988), was determined as 230.31 ± 11.28 mg GAE g–1 dm. This value is markedly higher than that reported by Celep et al. (40), who recorded 81.58 ± 3.66 mg GAE >g–1 dm in the dry extract obtained from the aerial parts of L. stoechas ssp. stoechas, using 80 % methanol as the extraction solvent. Similarly, aqueous-EtOH extracts (1:1, V/V) of Lavandula angustifolia from Romania, likely prepared from aerial parts, yielded a significantly lower TPC of 50.6 ± 3.2 mg GAE g–1, highlighting the influence of species and extraction protocol on polyphenol recovery (41). In contrast, Karabagias et al. (42) reported a TPC of 217 mg GAE L–1 for the methanolic extract and 4289 mg GAE L–1 for the aqueous extract of L. stoechas flowers. Discrepancies across the studies, despite often contradictory, emphasise that phenolic recovery is influenced by multiple factors, including solvent polarity, the species/plant part used, species-specific phenolic profiles, extraction temperature and time.

The complexity of the issue of flavonoids' solubility also includes structural/mechanistic features of flavonoids and inter/intramolecular interactions (e.g., hydrogen bonding, delocalisation, structure/planarity, functional groups) (43). Generally, poor solubility of flavonoids in water compared to organic solvents like methanol or acetone, underscores the central role of solvent-solute interactions in extraction efficiency. Flavonoids typically display low aqueous solubility due to their hydrophobic aromatic backbone, whereas organic solvents such as ethanol can establish stronger hydrogen-bonding and π–π interactions, thereby enhancing solubilization and facilitating higher recovery yields.

Individual phenolic composition. – It was analysed in LsHE using HPLC-DAD, and the chromatograms revealed distinct peaks corresponding to various phenolic acids and flavonoids (Fig. 2). The detailed quantification results are presented in Table III. Among the detected compounds, rosmarinic acid exhibited the highest concentration (526.762 mg g–1 dm), followed by quercetin (215.335 mg g–1 dm), confirming their predominance in the extract. These findings are consistent with those of Karabagias et al. (42), who reported the presence of caffeic acid, quercetin-O-glucoside, luteolin-O-glucuronide and rosmarinic acid in L. stoechas, contributing to its strong antioxidant capacity.

image2.png

Fig. 2. Overlay chromatogram of the LsHE and the phenolic standards used for the qualitative identification of phenolic compounds in the LsHE.

Table III. Phenolic compounds in LsHE extract

CompoundConcentration (mg L–1)Amount in dry plant (mg g–1 dm)
Caffeic acid< LOD –
Chlorogenic acid< LOD –
Ferulic acid< LOD –
QuercetinLOD < 1.786 < LOQ215.335
Rosmarinic acid4.369526.762
Rutin< LOD –

Rosmarinic acid (RA) has been extensively studied for its antioxidant, anti-inflammatory and pro-apoptotic effects. For instance, it significantly inhibited the proliferation of WiDr colon cancer cells by modulating apoptosis-related genes, including downregulation of BCL-2 and upregulation of caspase-1 and -7 (44). Lu et al. (45) further demonstrated that RA scavenges reactive oxygen species (ROS) and enhances endogenous antioxidant enzymes such as SOD and CAT via activation of the Nrf2 pathway. Likewise, Jang et al. (46) reported that RA induced apoptosis in prostate cancer cells through the mitochondrial pathway by upregulating Bax and caspase-3, and downregulating HDAC2 and BCL-2.

Quercetin, the second most abundant compound in LsHE, has also been documented to possess multiple biological activities, including antioxidant, anti-inflammatory and pro-apoptotic effects. It has been shown to inhibit the viability of colon cancer cells (CT26, MC38, Caco-2, SW620) by modulating apoptotic pathways, including downregulation of BCL-2 and upregulation of Bax expression (47, 48). Moreover, Han et al. (49) reported that quercetin decreases pro-inflammatory markers such as TNF-α, IL-6, and COX-2 through inhibition of the TLR4/NF-κB signalling cascade.

For ferulic, caffeic and chlorogenic acids, as well as rutin, detectable signals were observed; still, their concentrations were below the calculated LOD values.

TAC analysis. – Based on the ascorbic acid calibration curve (y = 3.956x – 0.0227, R² = 0.988), the total antioxidant capacity of the LsHE was measured as 0.1218 ± 0.0075 mg AAE g–1 dm. Compared to that, Celep et al. (40) reported 67.07 ± 3.79 mg AAE g–1 dm for the 80 % methanolic extract of L. stoechas, prepared from the aerial parts, using the same assay. Similarly, a study conducted by Ezzobi et al. (50) reported that the total antioxidant capacity of a 4:1 (V/V) ethanol–water extract obtained from the aerial parts of L. stoechas, collected from Morocco, was 255.5 µg mL–1 AAE, as determined by the phosphomolybdenum method. These variations in antioxidant capacity among studies can be attributed to differences in extraction solvents and the geographical origin of plant materials; nevertheless, the consistent use of aqueous ethanolic systems and similar analytical methods highlights the overall high antioxidant potential of L. stoechas extracts.

Cytotoxicity

The antiproliferative effects of the LsHE were evaluated on HT-29 colorectal cancer cells and HEK-293 normal epithelial cells using the Alamar blue assay. Based on the nonlinear regression analysis of the dose–response curve (Fig. 3), the concentration of LsHE required to inhibit 50 % of cell viability was determined as 86.37 ± 3.07 µg mL–1 for HT-29 cells and 131.30 ± 9.33 µg mL–1 for HEK-293 cells, yielding a selectivity index (SI) of approximately 1.5.

image3.jpeg

Fig. 3. Cytotoxic effects of LsHE on HT-29 and HEK-293 cells. Dose-response curves were generated to determine the LsHE concentration required to inhibit 50 % of cell viability. Data represent mean ± SD (n = 3).

The observed cytotoxicity of LsHE on HT-29 cells is in line with previous studies reporting the antiproliferative effects of L. stoechas extracts on different cancer cell lines. For instance, the essential oil of L. stoechas exhibited potent cytotoxic activity against the COL-22 colon cancer cell line, with an ED₅₀ value of 9.8 µg mL–1, which may be attributed to the higher lipophilicity and greater concentration of volatile bioactives in essential oils compared to polar solvent-based extracts (24). Similarly, Bouyahya et al. (51) reported that an ethanolic extract of L. stoechas, prepared from the aerial parts, showed significant cytotoxicity on the human rhabdomyosarcoma (RD) cell line, with an IC50 of 19.03 ± 2.05 µg mL–1. Although RD is a different cancer model, the similarity in the extraction method supports the relevance of solvent-dependent activity. In contrast, a methanolic extract of L. stoechas, prepared from the aerial parts of Lesvos island, exhibited low cytotoxicity on Caco-2 colon cancer cells, with LC50 values exceeding 75 µg mL–1 (52). Furthermore, an ethanolic extract prepared from the aerial parts of L. stoechas was reported to exhibit weak cytotoxicity against HepG2 liver cancer cells, with concentrations required to inhibit 50 % of cell viability ranging from 1000 to 1500 µg mL–1 (53). This discrepancy may be attributed to several factors, including the plant part used (aerial parts vs. flowers), the extraction model and the cancer cell line tested. The comparatively stronger effect observed in our study may result from the higher phenolic content of the flower-derived LsHE extract, particularly its enrichment in rosmarinic acid and quercetin.

The observed activity may be partially attributed to the major phenolics in LsHE, namely, rosmarinic acid and quercetin. Rosmarinic acid has been shown to induce apoptosis in WiDr colon cancer cells (44), while quercetin exerts dose-dependent cytotoxic effects on several colorectal cell lines such as CT26, Caco-2 and SW620 (47, 48). Phenolic hydroxyl groups of these compounds are believed to contribute to their anticancer activity through hydrogen bonding and redox interactions with DNA and apoptosis-related proteins (54, 55). Overall, the moderate cytotoxicity, observed in this study may arise from the synergistic activity of these constituents. The distinct difference of concentration for 50 % inhibition between normal and cancerous cells further supports the therapeutic promise of LsHE in colorectal cancer management.

Apoptosis/necrosis – Gene expression analysis

To determine the pro-apoptotic potential of LsHE, Annexin V-FITC/PI double staining was conducted on HT-29 and HEK-293 cells. In HT-29 cells, treatment with LsHE significantly increased both early and late apoptotic populations compared to the untreated group. Specifically, early apoptosis increased from 1.5 to 9.7 % (p < 0.0001), and late apoptosis rose from 1.3 to 6.8 % (p < 0.0001). These changes were accompanied by a reduction in live cells from 97.1 to 82.9 % (p < 0.0001) and a slight but statistically significant increase in necrotic cells from 0.1 to 0.6 % (p < 0.05) (Fig. 4). These results indicate that LsHE induces a shift from viability toward programmed cell death in HT-29 cells through apoptotic rather than necrotic mechanisms.

image4.jpeg

Fig. 4. Apoptosis analysis of HT-29 cells treated with LsHE for 48 h. Representative dot plots of Annexin V-FITC/PI staining obtained by flow cytometry in: a) untreated; b) DMSO; c) LsHE-treated groups; d) bar graph showing the distribution of live, early apoptotic, late apoptotic, and necrotic cells (%). Data are presented as mean ± SD (n = 3). Comparisons were performed among all groups within each cell population subtype (i.e., untreated vs. DMSO, untreated vs. LsHE, and DMSO vs. LsHE) for each cell population subtype (live, early, late, necrosis). Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Similarly, in HEK-293 cells, LsHE induced a robust early apoptotic response (35.5 %) and elevated late apoptosis (15.0 %), accompanied by decline in viable cells from 88.2 to 82.3 % (Fig. 5). These findings indicate that LsHE promotes apoptosis in both cancerous and non-cancerous cells, with a more pronounced and statistically validated effect in HT-29 cells.

image5.jpeg

Fig. 5. Apoptosis analysis of HEK-293 cells treated with LsHE for 48 h. Representative dot plots of Annexin V-FITC/PI staining obtained by flow cytometry in: a) untreated; b) DMSO; c) LsHE-treated groups; d) bar graph showing the distribution of live, early apoptotic, late apoptotic, and necrotic cells (%). Data are presented as mean ± SD (n = 3).

In parallel, qRT-PCR analyses were conducted to assess the expression of apoptosis- and inflammation-related genes, including BAX, BCL-2, CASP3 and TP53 (Fig. 6). BAX, a key pro-apoptotic gene in the intrinsic mitochondrial pathway, was significantly downregulated in both HEK-293 and HT-29 cells following LsHE treatment. In HEK-293 cells, LsHE administration led to a moderate but statistically significant reduction in BAX expression compared to the untreated group (p < 0.05). Similarly, in HT-29 cells, BAX expression was markedly suppressed after treatment with LsHE (p < 0.001), indicating a potential reduction in apoptotic signalling (Fig. 6).

image6.pngimage7.png

Fig. 6. Effect of LsHE on apoptotic gene expression in HEK-293 and HT-29 cells. Relative mRNA expression levels of pro-apoptotic BAX (a, e), anti-apoptotic BCL2 (b, f), CASP3 (c, g), and tumor suppressor TP53 (d, h) were assessed by qRT-PCR in HEK-293 (a–d) and HT-29 (e–h) cells after 48 h of treatment with LsHE. Gene expression was normalized to GAPDH. Data are presented as mean ± SD (n = 5). Significantly different vs. respective controls (untreated and DMSO): *p < 0.05, **p < 0.01, ***p < 0.001.

In both cell lines, LsHE treatment significantly upregulated the expression of the anti-apoptotic BCL-2 gene. In HEK-293 cells, BCL-2 mRNA levels were significantly elevated compared to untreated group (p < 0.05). A similar trend was observed in HT-29 colorectal cancer cells, where BCL-2 expression was higher than in untreated group but not significantly (Fig. 6).

Quantitative RT-PCR analysis revealed that LsHE treatment significantly upregulated CASP3 expression in both HEK-293 and HT-29 cells when compared to untreated group. In both cell lines, LsHE induced a significant increase in CASP3 mRNA levels relative to untreated group (p < 0.01), indicating a potential activation of caspase-mediated apoptotic signaling (Fig. 6), suggesting that caspase-3-dependent apoptosis is a key mechanism underlying LsHE-induced cytotoxicity in both cell types.

The BCL-2 family of proteins plays a central role in the regulation of apoptosis and is critically implicated in CRC initiation, progression, and resistance to therapy. Among the BCL-2 family proteins, anti-apoptotic members such as BCL-2 and pro-apoptotic effectors such as BAX and BAK play pivotal roles in the regulation of mitochondrial apoptosis through their interactions at the outer mitochondrial membrane (56). The pro-apoptotic proteins BAX and BAK initiate mitochondrial apoptosis by increasing outer membrane permeability, which in turn triggers the activation of the caspase cascade (57). Caspase-3, a key executioner caspase, is activated by upstream initiator caspases (caspase-8, -9, or -10) in both the intrinsic and extrinsic apoptotic pathways, ultimately driving the cleavage of cellular substrates and apoptotic cell death (58). TP53, encoding the tumor suppressor p53, serves as a major regulator of cell cycle arrest and apoptosis in response to stress. In CRC, TP53 is mutated in approximately 43 % of cases, highlighting its clinical relevance (59, 60). p53 promotes mitochondrial apoptosis through both transcription-dependent activation of pro-apoptotic genes like BAX and repression of anti-apoptotic genes like BCL-2, as well as transcription-independent interactions with BAX, BAK and BCL-2 at the mitochondria (61).

Numerous studies investigating Lavandula species and other medicinal plant extracts have reported pro-apoptotic gene expression profiles in various cancer models, including HT-29 cells. These studies commonly demonstrate upregulation of BAX, TP53 and CASP3, accompanied by downregulation of BCL-2, following treatment with plant-derived compounds (62–66).

In contrast, our study revealed a distinct expression pattern. Treatment with LsHE significantly downregulated BAX expression in both HEK-293 (p < 0.05) and HT-29 (p < 0.001) cells. Meanwhile, BCL-2 expression was significantly upregulated in HEK-293 cells (p < 0.05), and a similar trend was observed in HT-29 cells, although it was not statistically significant. Despite these observations, CASP3 expression was significantly increased in both cell lines (p < 0.01), suggesting the activation of caspase-dependent apoptotic pathways. Additionally, LsHE treatment led to a significant increase in TP53 mRNA levels in HT-29 cells (p < 0.05), with a moderate elevation also observed in HEK-293 cells.

These results differ from many previous studies, in which increased BAX and decreased BCL-2 expression are typically observed in response to plant-based treatments (65, 66). Interestingly, our findings are consistent with a recent study by Kadkhoda et al. (67), who reported similar gene expression dynamics and suggested that the anticancer effects of plant extracts may vary depending on concentration and phytochemical composition.

One possible explanation for the observed gene expression profile is the differential regulation within the BCL-2 family. Although BAK expression was not directly assessed in this study, it has been reported that anti-apoptotic proteins do not equally inhibit all pro-apoptotic members; specifically, BCL-2 fails to inhibit BAK effectively (68). This differential regulation suggests that LsHE may trigger apoptosis via a BAK-dependent pathway, potentially bypassing the need for BAX activation. The upregulation of TP53 and CASP3, despite the downregulation of BAX, suggests that p53-mediated, caspase-3-dependent apoptosis is a dominant mechanism in LsHE-treated HT-29 cells.

These results are consistent with previous studies reporting that various plant-derived products, including Lavandula extracts and phenolic constituents such as rosmarinic acid, promote apoptosis in various cancer cell lines, including HT-29 colorectal, MCF-7, and SK-BR-3 breast cancer cells, by activating the p53 pathway and caspase-3 expression (62–64, 66). It is also plausible that cytoplasmic p53 contributed to apoptosis in our study via transcription-independent mechanisms, such as direct interaction with mitochondrial proteins (61).

Flow cytometry results further support these findings, confirming an increase in apoptotic cell populations following LsHE treatment. Taken together, these results indicate that LsHE may trigger apoptosis through alternative molecular pathways that are independent of BCL-2 and BAX regulation but dependent on TP53 and CASP3 activation.

These results are in agreement with previous studies on L. stoechas and its bioactive components, which have been shown to trigger apoptosis through similar mechanisms. For instance, Rasheed et al. (29) demonstrated that oleanolic acid isolated from L. stoechas significantly induced apoptosis in MCF-7 breast cancer cells, as evidenced by increased early and late apoptotic cell populations detected by Annexin V-FITC/PI staining. This effect was further supported by the upregulation of BAX, TP53 and CASP3, along with downregulation of BCL-2, indicating mitochondrial pathway involvement. In another study, Tayarani-Najaran et al. (69) reported that methanolic L. stoechas extract protected PC12 neuronal cells from oxidative stress-induced apoptosis by downregulating pro-apoptotic markers and upregulating BCL-2, highlighting the context-dependent dual behaviour of L. stoechas in promoting or preventing apoptosis depending on the cell type and physiological condition.

In light of these findings, our results suggest that LsHE exerts a pronounced pro-apoptotic effect in HT-29 colorectal cancer cells, as shown by the significant increase in early and late apoptotic populations and elevated CASP3 and TP53 expression. These data support the idea that LsHE may activate caspase-dependent apoptosis, possibly via a p53-mediated pathway, even in the absence of BAX upregulation, further reinforcing the mechanistic versatility of Lavandula-derived phytochemicals in cancer models.

Limitations of the study

Limitations of the present study include the relatively low selectivity index of LsHE and the incomplete chemical characterisation of LsHE, as several peaks still remained unidentified.

CONCLUSIONS

This study demonstrated that LsHE exerts promising antiproliferative and pro-apoptotic effects on HT-29 human colorectal cancer cells. Phytochemical analysis revealed high levels of phenolic compounds, particularly rosmarinic acid and quercetin, which likely contribute to the observed bioactivity. LsHE-induced apoptosis was confirmed by Annexin V/PI staining and upregulation of TP53 and CASP3 gene expression. Interestingly, the concurrent downregulation of BAX suggests that LsHE may trigger apoptosis via alternative pathways, independent of the classical BAX/BCL-2 axis.

The present findings offer valuable mechanistic insight into the anticancer potential of L. stoechas and support its further evaluation as a candidate for phytochemical-based adjunctive therapy in colorectal cancer. To strengthen the translational relevance of these findings, future studies should address current limitations by confirming gene-level changes at the protein level and validating efficacy through in vivo experiments.

Supplementary material is available upon request.

Abbreviations, acronyms, symbols. – AAE – ascorbic acid equivalent, ATCC – American Type Culture Collection, BAX – Bcl-2-associated X protein, BCL-2 – B-cell lymphoma 2, CASP3 – caspase-3, DMSO – dimethyl sulfoxide, dm – dry mass, DMEM – Dulbecco’s modified eagle medium, FBS – fetal bovine serum, GAE – gallic acid equivalent, GAPDH – glyceraldehyde-3-phosphate dehydrogenase, LOD/LOQ – limit of detection/quantification, PBS – phosphate-buffered saline, PI – propidium iodide, RA – rosmarinic acid, SI – selectivity index, TAC – total antioxidant capacity, TP53 – tumor protein p53.

Acknowledgements. – The authors are thankful to Assoc. Prof. Dr. İlker Genç (Faculty of Pharmacy, Istanbul University, Istanbul, Turkey) for the botanical identification of the plant material. The authors also acknowledge Prof. Dr Hüsamettin Vatansever (Department of Medical Biochemistry, Faculty of Medicine, Selcuk University, Konya, Turkey) for his support in the procurement of cell cultures. This research was supported by the University of Health Sciences research foundation.

Conflicts of interest. – The authors declare no conflict of interest.

Funding. – This research was funded by the University of Health Sciences research foundation under Grant (2021/115 and 2022/100).

Authors contributions. – Conceptualization, Z.D. and M.S.D.; methodology, Z.D., M.S.D., and Ö.K.; investigation, G.Y., M.E., and Ö.K.; data analysis, Z.D., M.S.D., G.Y., Ö.K., and M.E.; visualization, Z.D. and Ö.K.; writing-original draft preparation, Z.D. and M.S.D.; writing-review and editing, Z.D. and M.S.D.; supervision, Z.D. and M.S.D. All authors have read and agreed to the published version of the manuscript.

References

1 

H. Sung, J. Ferlay, R. L. Siegel, M. Laversanne, I. Soerjomataram, A. Jemal and F. Bray, Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries,. CA Cancer J. Clin. 71(3)2021209–249. https://doi.org/10.3322/caac.21660

2 

A. K. Rustgi, The genetics of hereditary colon cancer,. Genes Dev. 21:20072525–2538. https://doi.org/10.1101/gad.1593107

3 

Y. Dong, J. Zhou, Y. Zhu, L. Luo, T. He, H. Hu, H. Liu, Y. Zhang, D. Luo, S. Xu, L. Xu, J. Liu, J. Zhang and Z. Teng, Abdominal obesity and colorectal cancer risk: Systematic review and meta-analysis of prospective studies, Biosci. Rep. 37(6)2017Article ID BSR20170945 (19 pages);. https://doi.org/10.1042/BSR20170945

4 

P. Ye, Y. Xi, Z. Huang and P. Xu, Linking obesity with colorectal cancer: Epidemiology and mechanistic insights,. Cancers. 12(6)2020Article ID 1408 (20 pages);. https://doi.org/10.3390/cancers12061408

5 

P. H. Liu, K. Wu, K. Ng, A. G. Zauber, L. H. Nguyen, M. Song and Y. Cao, Association of obesity with risk of early-onset colorectal cancer among women,. JAMA Oncol. 5(1)201937–44. https://doi.org/10.1001/jamaoncol.2018.4280

6 

T. Jess, C. Rungoe and L. Peyrin-Biroulet, Risk of colorectal cancer in patients with ulcerative colitis: A meta-analysis of population-based cohort studies, Clin. Gastroenterol. Hepatol. 10:2012639–645. https://doi.org/10.1016/j.cgh.2012.01.010

7 

M. S. Nadeem, V. Kumar, F. A. Al-Abbasi, M. A. Kamal and F. Anwar, Risk of colorectal cancer in inflammatory bowel diseases, Semin. Cancer Biol. 64:202051–60. https://doi.org/10.1016/j.semcancer.2019.05.001

8 

E. Dekker, P. J. Tanis, J. L. Vleugels, P. M. Kasi and M. Wallace, Colorectal cancer,. Lancet. 394:20191467–1480. https://doi.org/10.1016/S0140-6736(19)32319-0

9 

M. G. Guren, The global challenge of colorectal cancer, Lancet Gastroenterol. Hepatol. 4:2019894–895. https://doi.org/10.1016/S2468-1253(19)30329-2

10 

R. L. Siegel, K. D. Miller, A. Goding Sauer, S. A. Fedewa, L. F. Butterly, J. C. Anderson and A. Jemal, Colorectal cancer statistics,. 2020CA Cancer J. Clin. 70:2020145–164. https://doi.org/10.3322/caac.21601

11 

N. Keum and E. Giovannucci, Global burden of colorectal cancer: Emerging trends, risk factors and prevention strategies,. Nat. Rev. Gastroenterol. Hepatol. 16:2019713–732. https://doi.org/10.1038/s41575-019-0189-8

12 

J. Guinney, R. Dienstmann, X. Wang, A. De Reynies, A. Schlicker, C. Soneson and S. Tejpar, The consensus molecular subtypes of colorectal cancer,. Nat. Med. 21:20151350–1356. https://doi.org/10.1038/nm.3967

13 

S. Kopetz, A. Grothey and J. Tabernero, Encorafenib, binimetinib, and cetuximab in BRAF V600E-mutated colorectal cancer, N. Engl. J. Med. 382(9)2020877–878. https://doi.org/10.1056/nejmc1915676(Correspondence to the Editor).

14 

S. Kopetz, K. A. Guthrie, V. K. Morris, H. J. Lenz, A. M. Magliocco, D. Maru and H. S. Hochster, Randomized trial of irinotecan and cetuximab with or without vemurafenib in BRAF-mutant metastatic colorectal cancer (SWOG S1406),. J. Clin. Oncol. 39:2021285–294. https://doi.org/10.1200/JCO.20.01994

15 

M. Ekor, The growing use of herbal medicines: Issues relating to adverse reactions and challenges in monitoring safety, Front. Pharmacol. 4:2014Article ID 177 (10 pages);. https://doi.org/10.3389/fphar.2013.00177

16 

A. Garcia-Alvarez, B. Egan, S. De Klein, L. Dima, F. M. Maggi, M. Isoniemi and L. Serra-Majem, Usage of plant food supplements across six European countries: Findings from the PlantLIBRA consumer survey,. PLoS One. 9:2014e92265;. https://doi.org/10.1371/journal.pone.0092265

17 

A. S. van Wyk and G. Prinsloo, Health, safety and quality concerns of plant-based traditional medicines and herbal remedies, S. Afr. J. Bot. 133:202054–62. https://doi.org/10.1016/j.sajb.2020.06.031

18 

R. Kotecha, A. Takami and J. L. Espinoza, Dietary phytochemicals and cancer chemoprevention: A review of clinical evidence,. Oncotarget. 7:201652517–52529. https://doi.org/10.18632/oncotarget.9593

19 

Z. Liu, Z. Ren, J. Zhang, C. C. Chuang, E. Kandaswamy, T. Zhou and L. Zuo, Role of ROS and nutritional antioxidants in human diseases,. Front. Physiol. 9:2018Article ID 477 (14 pages);. https://doi.org/10.3389/fphys.2018.00477

20 

C. Tiffon, The impact of nutrition and environmental epigenetics on human health and disease,. Int. J. Mol. Sci. 19(11)2018Article ID 3425 (19 pages);. https://doi.org/10.3390/ijms19113425

21 

Y. Guo, Z. Y. Su and A. N. T. Kong, Current perspectives on epigenetic modifications by dietary chemopreventive and herbal phytochemicals,. Curr. Pharmacol. Rep. 1:2015245–257. https://doi.org/10.1007/s40495-015-0023-0

22 

M. Samec, A. Liskova, P. Kubatka, S. Uramova, P. Zubor, S. M. Samuel and D. Büsselberg, The role of dietary phytochemicals in the carcinogenesis via the modulation of miRNA expression,. J. Cancer Res. Clin. Oncol. 145:20191665–1679. https://doi.org/10.1007/s00432-019-02940-0

23 

A. Everest and E. Ozturk, Focusing on the ethnobotanical uses of plants in Mersin and Adana provinces (Turkey),. J. Ethnobiol. Ethnomed. 1:2005Article ID 6 (6 pages);. https://doi.org/10.1186/1746-4269-1-6

24 

A. C. Gören, G. Topçu, G. Bilsel, M. Bilsel, Z. Aydoğmuş and J. M. Pezzuto, The chemical constituents and biological activity of essential oil of Lavandula stoechas ssp. stoechas, Z. Naturforsch. 57:2002797–800. https://doi.org/10.1515/znc-2002-9-1007

25 

F. Algieri, A. Rodriguez-Nogales, T. Vezza, J. Garrido-Mesa, N. Garrido-Mesa, M. P. Utrilla and J. Galvez, Anti-inflammatory activity of hydroalcoholic extracts of Lavandula dentata L. and Lavandula stoechas L., J. Ethnopharmacol. 190:2016142–158. https://doi.org/10.1016/j.jep.2016.05.063

26 

T. Baytop, Therapy with Medicinal Plants in Turkey – Past and Present,. 2^(nd) ed.,. Nobel Kitap Evi,; Istanbul: 1999p. 284–285

27 

M. N. Boukhatem, T. Sudha, N. H. E. Darwish, H. Chader, A. Belkadi, M. Rajabi, A. Houche, F. Benkebailli, F. Oudjida and S. A. Mousa, A new eucalyptol-rich lavender (Lavandula stoechas L.) essential oil: Emerging potential for therapy against inflammation and cancer,. Molecules. 25(16)2020Article. 3671:https://doi.org/10.3390/molecules25163671

28 

L. S. Pimentel, L. M. Bastos, L. R. Goulart and L. N. D. M. Ribeiro, Therapeutic effects of essential oils and their bioactive compounds on prostate cancer treatment,. Pharmaceutics. 16(5)2024Article ID 583 (24 pages);. https://doi.org/10.3390/pharmaceutics16050583

29 

H. M. Rasheed, U. Farooq, K. Bashir, F. Wahid, T. Khan, A. Khusro and M. U. K. Sahibzada, Isolation of oleanolic acid from Lavandula stoechas and its potent anticancer properties against MCF-7 cancer cells via induced apoptosis,. J. King Saud Univ. Sci. 35:2023Article ID 102454 (11 pages);. https://doi.org/10.1016/j.jksus.2022.102454

30 

L. Yu, M. M. Zhang and J. G. Hou, Molecular and cellular pathways in colorectal cancer: Apoptosis, autophagy and inflammation as key players,. Scand. J. Gastroenterol. 57:20221279–1290. https://doi.org/10.1080/00365521.2022.2088247

31 

Y. Yilmaz and R. T. Toledo, Oxygen radical absorbance capacities of grape/wine industry byproducts and effect of solvent type on extraction of grape seed polyphenols,. J. Food Comp. Anal. 19:200641–48. https://doi.org/10.1016/j.jfca.2004.10.009

32 

M. Pinelo, M. Rubilar, M. Jerez, J. Sineiro and M. J. Núñez, Effect of solvent, temperature, and solvent-to-solid ratio on the total phenolic content and antiradical activity of extracts from different components of grape pomace,. J. Agric. Food Chem. 53:20052111–2117. https://doi.org/10.1021/jf0488110

33 

V. L. Singleton and J. A. Rossi, Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents,. Am. J. Enol. Vitic. 16:1965144–158. https://www.ajevonline.org/content/16/3/144

34 

E. Yilmaz, M. Ege, D. Misirli, G. D. Sonmez, O. Kilic and M. Elmastas, Phytochemical analysis, DNA barcoding and DNA protective activity of Ferulago cassia Boiss., Pak. J. Bot. 55:20232221–2229. https://doi.org/10.30848/PJB2023-6(31)

35 

S. Ataseven, D. Misirli, F. Uzar, N. N. Türkan and M. Elmastaş, Determination of phenolic compound composition of water and ethanol extracts of horsetail (Equisetum arvense),. J. Integr. Anatol. Med. 2(2)20213–9

36 

International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use,ICH Harmonised Guideline – Validation of Analytical Procedures Q2(R2), ICH. Geneva,: 2023

37 

A. Shrivastava and V. B. Gupta, Methods for the determination of limit of detection and limit of quantitation of the analytical methods, Chron. Young Sci. 2(1)201121–25. https://doi.org/10.4103/2229-5186.79345

38 

L. Z. Lambarki, F. Jhilal, L. Slimani, R. El Hajji, F. Bakkali, S. Iskandar, M. El Jemli, B. Ihssane, W. El Ghali and T. Saffaj, Comparison of approaches for assessing detection and quantitation limits in bioanalytical methods using HPLC for sotalol in plasma, Sci. Rep. 15:2025Article ID 5472(12 pages);. https://doi.org/10.1038/s41598-024-83474-5

39 

P. Prieto, M. Pineda and M. Aguilar, Spectrophotometric quantitation of antioxidant capacity through the formation of a phosphomolybdenum complex: Specific application to the determination of vitamin E, Anal. Biochem. 269:1999337–341. https://doi.org/10.1006/abio.1999.4019

40 

E. Celep, S. Akyüz, Y. İnan and E. Yesilada, Assessment of potential bioavailability of major phenolic compounds in Lavandula stoechas L. ssp. stoechas, Ind. Crops Prod. 118:2018111–117. https://doi.org/10.1016/j.indcrop.2018.03.041

41 

I. Spiridon, S. Colceru, N. Anghel, C. A. Teaca, R. Bodirlau and A. Armatu, Antioxidant capacity and total phenolic contents of oregano. (Origanum vulgare), lavender (Lavandula angustifolia) and lemon balm (Melissa officinalis) from Romania, Nat. Prod. Res. 25 (2011) 1657–1661;. https://doi.org/10.1080/14786419.2010.521502

42 

I. K. Karabagias, V. K. Karabagias and K. A. Riganakos, Physico-chemical parameters, phenolic profile, in vitro antioxidant activity and volatile compounds of ladastacho (Lavandula stoechas) from the region of Saidona,. Antioxidants. 8(4)2019Article ID 80 (16 pages);. https://doi.org/10.3390/antiox8040080

43 

X. Dong, X. Li, X. Ruan, L. Kong, N. Wang, W. Gao and M. Jin, A deep insight into the structure–solubility relationship and molecular interaction mechanism of diverse flavonoids in molecular solvents, ionic liquids, and molecular solvent/ionic liquid mixtures,. J. Mol. Liq. 385:2023Article ID 122359 (53 pages);. https://doi.org/10.1016/j.molliq.2023.122359

44 

F. Laila, D. Fardiaz, N. D. Yuliana, M. R. M. Damanik and F. N. A. Dewi, Methanol extract of Coleus amboinicus (Lour) exhibited antiproliferative activity and induced programmed cell death in colon cancer cell WiDr,. Int. J. Food Sci. 2020:2020Article ID 9068326 (12 pages);. https://doi.org/10.1155/2020/9068326

45 

Y.-H. Lu, Y. Hong, T.-Y. Zhang, Y.-X. Chen, Z.-J. Wei and C.-Y. Gao, Rosmarinic acid exerts anti-inflammatory effect and relieves oxidative stress via Nrf2 activation in carbon tetrachloride-induced liver damage, Food Nutr. Res. 66:2022Article ID 8359 (13 pages);. https://doi.org/10.29219/fnr.v66.8359

46 

Y.-G. Jang, K.-A. Hwang and K.-C. Choi, Rosmarinic acid, a component of rosemary tea, induced the cell cycle arrest and apoptosis through modulation of HDAC2 expression in prostate cancer cell lines,. Nutrients. 10(11)2018Article ID 1784 (15 pages);. https://doi.org/10.3390/nu10111784

47 

J. Y. Kee, Y. H. Han, D. S. Kim, J. G. Mun, J. Park, M. Y. Jeong and S. H. Hong, Inhibitory effect of quercetin on colorectal lung metastasis through inducing apoptosis, and suppression of metastatic ability,. Phytomedicine. 23:20161680–1690. https://doi.org/10.1016/j.phymed.2016.09.011

48 

X.-A. Zhang, S. Zhang, Q. Yin and J. Zhang, Quercetin induces human colon cancer cells apoptosis by inhibiting the nuclear factor‐kappa B pathway, Pharmacogn. Mag. 11(42)2015404–409. https://doi.org/10.4103/0973-1296.153096

49 

M. Han, Y. Song and X. Zhang, Quercetin suppresses the migration and invasion in human colon cancer Caco‐2 cells through regulating toll‐like receptor 4/nuclear factor‐kappa B pathway, Pharmacogn. Mag. 1246(46)2016237–244. https://doi.org/10.4103/0973-1296.182154

50 

Y. Ez Zoubi, D. Bousta, M. Lachkar and A. Farah, Antioxidant and anti-inflammatory properties of ethanolic extract of Lavandula stoechas L. from Taounate region in Morocco,. Int. J. Phytopharm. 5:201421–26

51 

A. Bouyahya, A. Et-Touys, J. Abrini, A. Talbaoui, H. Fellah, Y. Bakri and N. Dakka, Lavandula stoechas essential oil from Morocco as novel source of antileishmanial, antibacterial and antioxidant activities,. Biocatal. Agric. Biotechnol. 12:2017179–184. https://doi.org/10.1016/j.bcab.2017.10.003

52 

R. B. Badisa, O. Tzakou, M. Couladis and E. Pilarinou, Cytotoxic activities of some Greek Labiatae herbs,. Phytother. Res. 17:2003472–476. https://doi.org/10.1002/ptr.1175

53 

M. A. Siddiqui, H. H. Siddiqui, A. Mishra and A. Usmani, Evaluation of cytotoxic activity of Lavandula stoechas aerial parts fractions against HepG2 cell lines, Curr. Bioact. Compd. 16:20201281–1289. https://doi.org/10.2174/1573407215666190916102325

54 

M. Abotaleb, A. Liskova, P. Kubatka and D. Büsselberg, Therapeutic potential of plant phenolic acids in the treatment of cancer,. Biomolecules. 10(2)2020Article ID 221 (23 pages);. https://doi.org/10.3390/biom10020221

55 

S. Jafari, S. Saeidnia and M. Abdollahi, Role of natural phenolic compounds in cancer chemoprevention via regulation of the cell cycle,. Curr. Pharm. Biotechnol. 15:2014409–421. https://doi.org/10.2174/1389201015666140813124832

56 

A. S. Y. Kong, S. Maran and H. S. Loh, Navigating the interplay between BCL-2 family proteins, apoptosis, and autophagy in colorectal cancer, Adv. Cancer Biol. Metastasis. 11:2024Article ID 100126 (9 pages);. https://doi.org/10.1016/j.acb.2024.100126

57 

N. Mehrotra, S. Kharbanda and H. Singh, BH3 mimetics in cancer therapy and their future perspectives with nanodelivery,. Nanomedicine. 16:20211067–1070. https://doi.org/10.2217/nnm-2021-0059

58 

F. Sakanashi, M. Shintani, M. Tsuneyoshi, H. Ohsaki and S. Kamoshida, Apoptosis, necroptosis and autophagy in colorectal cancer: Associations with tumor aggressiveness and p53 status, Pathol. Res. Pract. 215(7)2019Article ID 152425 (6 pages);. https://doi.org/10.1016/j.prp.2019.04.017

59 

E. Gurpinar and K. H. Vousden, Hitting cancers' weak spots: Vulnerabilities imposed by p53 mutation,. Trends Cell Biol. 25:2015486–495. https://doi.org/10.1016/j.tcb.2015.04.001

60 

M. C. Liebl and T. G. Hofmann, The role of p53 signaling in colorectal cancer,. Cancers. 13(9)2021Article ID 2125 (29 pages);. https://doi.org/10.3390/cancers13092125

61 

Q. Hao, J. Chen, H. Lu and X. Zhou, The ARTS of p53-dependent mitochondrial apoptosis,. J. Mol. Cell Biol. 14(10)2022Article. 0748:https://doi.org/10.1093/jmcb/mjac074

62 

E. Mojodi, S. K. Sabbagh, K. Shahamiri and M. Rajabi, Antitumor effect of lavender essential oil-synthesized nanoparticles against MCF7 and SKBR3 cancer cell lines: cytotoxicity and gene expression analysis, Biomed. Res. Ther. 12:20257224–7235. https://doi.org/10.15419/bmrat.v12i3.965

63 

I. Malami, A. B. Abdul, R. Abdullah, N. K. B. Kassim, R. Rosli, S. K. Yeap and M. B. Bello, Crude extracts, flavokawain B and alpinetin compounds from the rhizome of Alpinia mutica induce cell death via UCK2 enzyme inhibition and in turn reduce 18S rRNA biosynthesis in HT-29 cells,. PLoS One. 12:20170170233:https://doi.org/10.1371/journal.pone.0170233

64 

G. Maitisha, M. Aimaiti, Z. An and X. Li, Allicin induces cell cycle arrest and apoptosis of breast cancer cells in vitro via modulating the p53 pathway, Mol. Biol. Rep. 48:20217261–7272. https://doi.org/10.1007/s11033-021-06722-1

65 

H. K. Permatasari, D. S. Wewengkang, N. I. Tertiana, F. Z. Muslim, M. Yusuf, S. O. Baliulina, V. P. A. Daud, A. A. Setiawan and F. Nurkolis, Anti-cancer properties of Caulerpa racemosa by altering expression of Bcl-2, BAX, cleaved caspase 3 and apoptosis in HeLa cancer cell culture,. Front. Oncol. 12:2022Article ID 964816 (11 pages);. https://doi.org/10.3389/fonc.2022.964816

66 

M. A. Mahmoud, T. M. Okda, G. A. Omran and M. M. Abd-Alhaseeb, Rosmarinic acid suppresses inflammation, angiogenesis, and improves paclitaxel induced apoptosis in a breast cancer model via NF-κB-p53-caspase-3 pathways modulation,. J. Appl. Biomed. 19(4)2021202–209. https://doi.org/10.32725/jab.2021.024

67 

P. Kadkhoda, A. R. Farimani, E. Chamani and S. M. Hashemi, Molecular mechanisms of HT-29 colorectal cancer cell death induced by Artemisia annua methanolic extract,. Modern Care J. 22(2)20241480908:https://doi.org/10.5812/mcj-148090

68 

B. Ku, C. Liang, J. U. Jung and B. H. Oh, Evidence that inhibition of BAX activation by BCL-2 involves its tight and preferential interaction with the BH3 domain of BAX,. Cell Res. 21:2011627–641. https://doi.org/10.1038/cr.2010.149

69 

Z. Tayarani-Najaran, E. Hadipour, S. M. S. Mousavi, S. A. Emami, L. Mohtashami and B. Javadi, Protective effects of Lavandula stoechas L. methanol extract against 6-OHDA-induced apoptosis in PC12 cells,. J. Ethnopharmacol. 273:2021Article ID 114023;. https://doi.org/10.1016/j.jep.2021.114023


This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.