Skip to the main content

Original scientific paper

https://doi.org/10.37427/botcro-2022-005

Determination of salt tolerance levels and genetic relationships of Vicia sativa cultivars using gene targeted functional markers

Iskender Tiryaki ; Canakkale Onsekiz Mart University, Faculty of Agriculture, Department of Agricultural Biotechnology, Terzioglu Campus, 17000 Canakkale, Turkey
Nuray Isidogru ; Canakkale Onsekiz Mart University, Faculty of Agriculture, Department of Agricultural Biotechnology, Terzioglu Campus, 17000 Canakkale, Turkey


Full text: english pdf 645 Kb

page 80-88

downloads: 771

cite

Download JATS file


Abstract

The objectives of the present study were to determine salt tolerance levels of 12 different common vetch (Vicia sativa L.) cultivars at germination stage in the presence of 250 mM NaCl and to reveal genetic relationships based on gene targeted functional markers (GTFMs) associated with salt tolerance. The results revealed the presence of a significant genetic variation among the cultivars although salt stress significantly reduced all germination parameters tested. The cultivar Ozveren was the most salt tolerant with 20.1% reduction in final germination percentage compared to control seeds while cultivars Alınoglu, Ayaz and Bakir did not germinate. The maximum delays in germination rate (G50 = 3.78 days) and synchrony (G10-90 = 3.45 days) were obtained from the cultivars Urkmez and Ozveren, respectively. The GTFMs provided a total of 53.1% polymorphism. The primers of MtSOS2 gene gave the highest numbers of alleles per primer pair while the highest polymorphism rate (77.8%) was obtained from the MtP5CS gene. The first three components of principal component analysis explained 57.63% of total variation. This study concluded that the cultivars determined to be salt tolerant and sensitive at germination stage distributed into three main clades determined by UPGMA analysis while the GTFMs associated with salt tolerance successfully determined the genetic relationships of common vetch cultivars.

Keywords

germination, gene, markers, salt tolerance, common vetch

Hrčak ID:

269981

URI

https://hrcak.srce.hr/269981

Publication date:

1.4.2022.

Visits: 2.143 *




Introduction

Soil salinity is one of the most important abiotic stress factors directly limiting plant yield in agricultural production areas of all over the world (Shokat and Großkinsky 2019). Plants respond to salts in soil or in irrigation water at different levels by tuning complex physiological and molecular mechanisms (Mel et al. 2019). High salt prevents the water uptake and creates a physiological drought (Khayamim et al. 2014) or ion toxicity to the embryo of seeds, which directly limits fast and even seed germination (Farooq et al. 2017). Salt tolerance level of a plant can vary based on plant developmental stage (Bu et al. 2015). Seed germination and seedling stages of plants are generally less tolerant than mature plants (Hussain et al. 2010). Therefore, determination of salt tolerance levels of cultivars at germination stage is one of the most important tasks to promote successful plant development for sustainable agricultural production.

The common vetch (Vicia sativa L.) is considered one of the most important annual, self-pollinated, diploid forage crop species and has plasticity not only for adaptability to different soil and climate conditions but also its diverse use as grain, straw, hay, silage, and green manure along with soil improvement ability with nitrogen fixation (Sherasia et al. 2017). The common vetch also provides valuable protein and mineral sources for cattle and poultry in Turkey, Australia, New Zealand, China and Eastern Europe (Firincioglu et al. 2007,Sherasia et al. 2017). Like many other legume crops, common vetch has, however, reduced growth and yield under saline condition and is considered more vulnerable to salt stress than some other major crop species such as cereals (Hussain et al. 2010).

To discriminate individuals from various breeding sources, PCR-based molecular markers are the best tool for genetic characterization and the estimation of genetic diversity in various organisms including plants (Poczai et al. 2013a). Molecular markers are also more reliable than pedigree data for parental selection to estimate genetic diversity in plants (Babic et al. 2016). However, the power of a molecular marker is mainly determined by the level of polymorphism detected (Wan et al. 2004). As a complex taxon, V. sativa represents a diverse phylogenetic relationship (Kartal et al. 2020). Various types of molecular markers have been previously used to resolve inter- and intra-specific diversity in common vetch by using SRAP and ISSR (Cil and Tiryaki 2016), SSRs (Raveendar et al. 2015),EST-SSR, (Liu et al. 2014),SCoT (Chai et al. 2017) and SNPs (De la Rosa et al. 2020). The recent sequencing advances in plant biotechnology resulted in an avalanche of information in terms of DNA sequences and functional gene determination in various plant species (Chai et al. 2017). Therefore, not only has the transferability of molecular markers among the species been studied (Raveendar et al. 2015) but new alternative molecular marker techniques have also been developed in diverse plant species (Poczai et al. 2013b). Of those, the molecular markers which are generated based on untranslated regions of expressed sequence tags (ESTs) are called gene-targeted markers (GTMs) (Poczai et al. 2013b) while the gene markers involved in the variation of phenotypic traits due to their functional gene sequences are called gene-targeted functional markers (GTFMs) (Arnholdt-Schmitt 2005).

This study aimed to determine the salt tolerance levels of 12 common vetch cultivars at germination stage by using seed germination parameters and to reveal genetic relationships based on salt tolerance-related gene primers. The aim of the study was also to reveal whether or not GTFMs can also distinguish the salt tolerance and sensitivity levels of common vetch cultivars at germination stage in the presence of 250 mM NaCl.

Material and methods
Seed material

All available 12 common vetch cultivars were kindly provided from the Ankara Field Crops Central Research Institute (Alınoglu, Ayaz, Ankaramoru, Bakir, Farukbey, Zemheri), Izmir Aegean Agricultural Research Institute (Alper, Cumhuriyet, Selcuk, Urkmez) and Adana Eastern Mediterranean Agricultural Research Institute in Turkey (Ozveren, Yucel). A range of NaCl concentrations were tested in pre-experimental trials and 250 mM NaCl was chosen to determine the salt tolerance levels of the 12 common vetch cultivars.

Germination experiment

A single layer of 50 seeds of each cultivar was placed in covered petri dishes (80 × 15 mm) on double layers of filter papers saturated with 4 mL of 250 mM NaCl. A temperature-controlled incubator kept at 20 ± 0.5 °C in darkness was used for germination test. Four replications of 50 seeds were arranged in a completely randomized block design. Seeds showing a radicle exceeding 2 mm in length emerging from the testa were recorded as germinated. The germinated seeds were daily removed from the petri dishes until the germination count was unchanged for 3 subsequent days (total 15 days). The final germination percentage (FGP), germination rate and span of germination parameters were determined as described previously (Tiryaki and Kaplan 2019). Germination rate was used to estimate days to 50% of FGP (G50) and the span of germination (G10-90) was used to estimate the time from 10% to 90% of FGP by using methods described previously (Tiryaki and Kaplan 2019). The control seeds of each cultivar were treated with 4 mL of dH2O and were germinated under the same germination conditions used for the salt experiment as described above.

DNA extraction and quality control

The seeds of each cultivar were planted in rows with 10 cm raw space in plastic boxes (10 × 35 × 45 cm) filled with peat with 3 cm planting depth and were incubated in a plant growth chamber with a 12 h light (350 µmol m-2 s-1)/dark cycle at 20 oC. The young leaves of five seedlings from each cultivar were bulked and were used for DNA extraction by using a plant genomic DNA extraction kit (Favorgen, Pingtung, Taiwan) following the manufacturer’s instruction. The DNA concentrations were estimated by comparing known concentration of λ DNA on 1% agarose-gel electrophoresis and were used in PCR analysis after concentration equalization.

Gene Targeted Functional Markers and PCR amplification

In all, nine gene specific primer pairs (Tab. 1) were used after PCR amplifications of each primer pair were optimized in a gradient PCR (Thermo Fisher Scientific, Inc., USA) to determine the best annealing temperature in common vetch genome. Eight of nine gene specific primer pairs were either directly or indirectly associated with salt tolerance in plants while MtActin (Medicago truncatula Actin) gene was used to reveal the level of variation of MtActin gene in the common vetch genome. The reaction mixtures of PCR were set in a 20.5 μL reaction mixture containing 100 μM each of dATP, dGTP, dCTP, and dTTP, 10 mM Tris-HCl, pH 8.8, 20 mM (NH4)2SO4, 2.0 mM MgCl2, 1 unit of Taq DNA polymerase (invitrogen), and 20 ng of genomic DNA (Kang et al. 2002). The PCR cycles were set as follows: 5 pre-cycles of 1 min at 95 ºC for denaturing, 45 seconds at 35 ºC for annealing and 30 seconds at 72 ºC for extension. Annealing temperature (Ta) of each primer was raised to the temperature given in Table 1 for 1 min for another 35 cycles along with 15 seconds at 95 ºC for denaturing, 1 min at 72 ºC for extension and 7 min at 72 ºC for final cycle extension. Amplicons of PCR products were separated on a 2% (w/v) agarose gel in 1×TBE buffer at constant 80 V for 3 h, stained with ethidium bromide (2 µL/100 mL) and visualized under UV light source.

Tab. 1 Salt tolerance related genes used as gene targeted functional markers in the study. The name of genes, references, forward (F) and reverse (R) primer sequences, annealing temperature (Ta), the number of amplicons, the number of polymorphic amplicons, polymorphism rate (%) and polymorphism information content (PIC) values. Medicago truncatula salt overly sensitive gene 1 (MtSOS1), M. truncatula salt overly sensitive gene 2 (MtSOS2), M. truncatula salt overly sensitive gene 3 (MtSOS3), Arabidopsis thaliana dehydration responsive element binding factor 1B (AtDREB1B), A. thaliana delta1 pyroline-5-carboxylate synthase (AtP5CS), M. truncatula delta1 pyroline-5-carboxylate synthase (MtP5CS), M. truncatula proline dehydrogenase (MtProDH), A. thaliana vacuolar Na+/H+ exchanger gene 1 (AtNHX1) and M. truncatula Actin (MtActin).
GeneReferenceF/ R primer 5'-3'

Annealing

temperature

(Ta.˚C)
No. of total ampliconsNo. of polymorphic ampliconsPolymorphism rate (%)PIC
MtSOS1(Liu et al., 2015)

GCTGACTTTCCCGTATG

TGGCACCCAGTTCTTTC

488675.00.50
MtSOS2(Liu et al., 2015)

CCGTGGTATCTTCTGTT

CAAGGGTTAGGTGTATT
4811545.50.29
MtSOS3(Liu et al., 2015)

TCTGAGGCAAACAGGGTA

CTGGGAAATGCTAAGGTAAT
48100.00.00
AtDREB1B(Wang et al., 2006)

GGATCCTGATCAATGAACTACATTTTC

AGCTCCCATTCTAAAAAGGAAC
504375.00.44
AtP5CS(Yamada et al., 2005)

TCAGAGGACTACGTGTTGGA

ATGAGTACTAAGCAGAGAGG

558675.00.32
MtP5CS(Quan et al., 2016)

GAGAGGGAACGGCCAAGTG

CAGATCCTTGTGTGTATA
529777.80.45
MtProDH(Planchet et al., 2014)

CCAACGTCCACGCTGATAAGA

ACAGGTCCTATAGCCGTTGCA
573133.30.19
AtNHX1(Yokoi et al., 2002)

CAACACCCCAAAATCCATAC

ATATCCCTTTGTTGGACCAA
527571.40.25
MtActin(Wang et al., 2017)

ACGAGCGTTTCAGATG

ACCTCCGATCCAGACA
504125.00.23
MEAN6.14.353.10.30
TOTAL5534--

Data analysis

An angular transformation (arcsine√FGP) was applied to the final germination percentage (FGP) data and was used in statistical analysis (Tiryaki and Kaplan 2019). To eliminate differences among the cultivars that might be due to the differences in percentages of live seeds in the seed stocks, an adjustment was performed for the FGP values of each cultivar determined under salt stress germination conditions as described before (Tiryaki and Andrews 2001) using the following equation: adjusted FGP value of cultivar n = [(FGP value of control seeds of cultivar n / FGP of salt stress seeds of cultivar n)] × 100. These values were then used to calculate the FGP reduction percentage  due to salt stress for each cultivar.

Analysis of variance was used to calculate statistically significant differences of germination rate, span of germination and transformed FGP data using SAS software (SAS 1997). The mean separation was done using Fisher’s least significant difference (LSD) test if the F-test was significant at P < 0.05. The presence (1) or absence (0) of DNA bands with high intensity was used for allele scoring. The polymorphism information content (PIC) of each primer was calculated as described before (Powell et al. 1996):

PIC= 1−∑(Pij)2

where Pij is the frequency of the ith band revealed by the jth primer, P(ij) is summed for all the bands of each primer. To determine the genetic similarity of the genotypes, numerical taxonomy multivariate analysis system (NTSYSpc-2.1) was used by using the Dice coefficient (Dice, 1945). The unweighted pair-group with arithmetic mean (UPGMA) method was used to construct the dendrogram. The EIGEN and PROJ modules of NTSYSpc-2.1 program were used for PCA (the principal component analysis) analysis.

Results
Effects of salt stress on germination performance of the cultivars

Salt stress significantly reduced the FGPs of all cultivars while the same cultivars had high final germination percentages (FGPs) in nonstress (control) conditions with a few exceptions (Fig. 1). The cultivars Ayaz, Alınoglu and Bakir had very low levels of FGPs under salt (0.4%, 0.7% and 0.6% of FGPs, respectively) stress conditions and the germination data of those cultivars were, therefore, excluded from further analysis. The seeds of cultivar Ozveren had the highest FGP in the presence of 250 mM NaCl and were determined to be the most salt tolerant cultivar at germination stage (Fig. 1). In contrast, the cultivars Zemheri and Ankaramoru were statistically the most sensitive cultivars to salt stress since they had the lowest FGPs (5.8% and 6.0%, respectively). The reduction rates in FGPs due to salt stress were 94.0% and 93.5% for the cultivars Zemheri and Ankaramoru, respectively while the cultivar Ozveren had the lowest reduction rate (20.1%) (Fig. 1).

Fig. 1 The final germination percentage (FGP) of Vicia sativa cultivars germinated in the presence of 250 mM NaCl and no salt conditions (control) at 20 ± 0.5 °C in darkness, and reduction rate (%) in FGP due to salt tolerance. Decline in FGP of each cultivar due to salt stress was presented as reduction percentage. The bars indicate standard deviation (n = 4). The means that differ significantly (Alpha = 0.05) are indicated by different letters.
ABC-81-80-f1

Salt stress significantly increased the time required for 50% of FGP in all cultivars (Fig. 2). The germination rates ranged from 1.07 days (Urkmez) to 2.21 days (Zemheri) under no salt stress conditions and from 4.0 days (Zemheri) to 5.62 days (Ankaramoru) (Fig. 2) at 250 mM NaCl. Due to salt stress, the highest delay in the time required for 50% of FGP was determined in the cultivar Urkmez with 3.78 days in comparison to control seeds while the cultivar Zemheri had the least delay (1.79 days) (Fig. 2).

Fig. 2 The time to 50% of final germination percentage (G50) of Vicia sativa cultivars germinated in the presence of 250 mM NaCl and no salt conditions (control) at 20 ± 0.5 °C in darkness. The bars indicate standard deviation (n = 4). The means that differ significantly (Alpha = 0.05) are indicated by different letters.
ABC-81-80-f2

The salt stress significantly extended the time required from 10% to 90% of FGP for all cultivars tested in comparison to control seeds (Fig. 3). The span of germination ranged from 2.02 days (Ankaramoru) to 4.45 days (Selcuk) and from 0.6 days (Ozveren) to 2.35 days (Zemheri) for stress and no stress conditions, respectively. The cultivars Zemheri and Ankaramoru had about the same span of germination in both salt stress (G10-90 = 2.37 days, G10-90 = 2.02 days) and no stress conditions (G10-90 = 2.35 days, G10-90 = 1.94), respectively (Fig. 3). Because of salt stress, the highest delay (G10-90 = 3.45 days) in the germination synchrony was determined with the cultivar Ozveren with 3.45 days (Fig. 3).

Fig. 3 The time from 10% to 90% of final germination percentage (G10-90) of Vicia sativa cultivars germinated in the presence of 250 mM NaCl and no salt conditions (control) at 20 ± 0.5 °C in darkness. The bars indicate standard deviation (n = 4). The means that differ significantly (Alpha = 0.05) are indicated by different letters.
ABC-81-80-f3
Genetic diversity based on GTFMs

Nine loci specific markers produced a total of 55 alleles 34 of which were polymorphic (Tab. 1). The MtSOS3 (M. truncatula salt overly sensitive gene 3) gene marker provided one monomorphic band only. The polymorphism rate of the markers used in the study ranged from 25.0% to 77.8% with an average of 53.1% per locus. The numbers of amplicons per marker changed from 1 to 11, an average of 6.1 alleles. The marker MtSOS2 had the highest number of amplicons (11 bands) and 5 of them were polymorphic while the polymorphism rate of MtP5CS (M. truncatula Delta1 pyroline-5-carboxylate synthase) gene marker produced the highest polymorphism rate (77.8%). The average PIC values of nine markers changed from none to 0.50 with an average of 0.30 while the marker MtSOS1 (M. truncatula salt overly sensitive gene 1) had the highest (0.50) (Tab. 1).

Fig. 4 Genetic similarity dendrogram based on Nei (1972) for 12 Vicia sativa cultivars created according to the UPGMA method using 9 salt tolerance-related gene targeted functional markers. Asterisk (*), indicates the cultivars which did not germinate at 250 mM NaCl. The different letters given in the parentheses indicate statistical mean differences (Alpha = 0.05) of final germination percentage for the cultivars germinated at 250 mM NaCI.
ABC-81-80-f4

Twelve common vetch cultivars were divided into three main clades based on UPGMA analysis generated by using 55 alleles (Fig. 4). The cluster analysis revealed that the cultivars Alınoglu and Farukbey were grouped in clade I and distinctly separated from the others (Fig. 4). Clades II and III shared the remaining cultivars equally. The Eigen values of the C1, C2 C3 components of PCA analysis explained 57.63% of total variation. The two- and three-dimensional plots of PCA analysis also showed that the cultivars Ayaz and Yucel were cultivars the most distinct from each other (Fig. 5).

Fig. 5 Two (a) and three-dimensional (b) PCA plots of 12 Vicia sativa cultivars analyzed by 9 salt tolerance related gene targeted functional markers. The Eigen values of C1, C2 and C3 components were 23.87, 20.39 and 13.35%, respectively. Asterisk (*), indicates the cultivars which did not germinate at 250 mM NaCl. The most and the only moderately salt tolerant cultivars are indicated by filled and open thicker circles, respectively.
ABC-81-80-f5
Discussion

The results of this study showed that final germination percentage, germination rate and span of germination parameters of 12 common vetch cultivars were significantly reduced at 250 mM NaCl and that the adverse effects of salt stress varied according to the cultivar used. These results revealed the presence of genetic variation among the common vetch cultivars for salt tolerance level at germination stage. Cultivar Ozveren was the most salt tolerant with 20.1% reduction rate in FGP at 250 mM NaCl while cultivars Alınoglu, Ayaz and Bakir did not germinate (Fig. 1). High salt concentration also significantly delayed the time required for 50% of FGP in all cultivars (Fig. 2) while span of germination was not changed for cultivars Zemheri and Ankaramoru (Fig. 3). These findings suggested that FGP and germination rate are better parameters to determine salt tolerance levels of the common vetch cultivars than span of germination. Similarly, a greater salt susceptibility and a better detection of genotypic variability in germination rate under salt stress were also reported for other plant species including Vicia faba L. (El-Bok et al. 2015) and Oryza sativa L. (Ologundudu et al. 2014). The results of this study also showed that the salt concentration used in this study can successfully be used to determine salt tolerance levels of common vetch cultivars at germination stage. Akhtar and Hussain (2009) reported that germination percentage of common vetch was significantly reduced at 150 mM NaCl which was used as the highest NaCl concentration tested. However, our pre-experiment trials showed that lower concentrations of NaCl were not able to discriminate the high salt tolerant common vetch cultivars from the moderate salt tolerant ones. Therefore, the right salt concentration is one of the most important prerequisites for the determination of salt tolerance levels of cultivars. Salt concentrations that are too high fully inhibit seed germination while relatively low salt concentrations are not able to distinguish salt tolerant genotypes from nontolerant or moderately tolerant. Previous reports indicated that Vicia sativa can tolerate moderate salt levels at germination stage (Akhtar and Hussain 2009) and the level of salt tolerance is less in comparison to Pisum sativum L. (Bilgili et al. 2011). However, this study revealed that the cultivars Ozveren, Alper, Urkmez and Cumhuriyet can be used as salt tolerant cultivars and should be compared with other important seed legume crops since they had relatively high FGPs at 250 mM NaCl which was generally considered a high salt concentration for legume plants at germination stage (Farooq et al. 2017). Adverse effects of salt stress at lower salt concentrations than in the current study were reported for other vetch species including Vicia pannonica Crantz. (Ertekin et al. 2018), V. faba and V. villosa Roth. (Lee et al. 2014) at germination stages.

We have used gene-specific primers as GTFMs which were directly or indirectly related to salt tolerance in plants (Tab. 1). All the primers of GTFMs amplified in common vetch genome and provided a total of 53.1% polymorphism rate (Tab. 1), suggesting a high degree of transferability for the primers of salt tolerance-related genes among distantly related species. The highest polymorphism rate was obtained from MtP5CS gene primers with 77.8% while MtSOS2 gene primers had the highest numbers of alleles per primer pair (11 bands). The MtSOS1 gene primers produced more polymorphic bands (75.0%) and gave the highest PIC value (0.50), higher than MtSOS2 (45.5%) and MtSOS3 (single monomorphic band only) genes. The MtSOS1 gene is known to be among the most important loci and provides a better salt tolerance to plants than other members of SOS genes (Shi et al. 2000). This study confirmed that MtSOS1 gene has more allelic variation in common vetch plants than the other members of the gene family and may play a more critical role in the control of salt tolerance in this genus. As a most abundant member of the sodium/proton antiporter gene family, AtNHX1 (Arabidopsis thaliana (L.) Heynh. vacuolar Na+/H+ exchanger gene 1) mediates salt tolerance in plants due to regulation of Na+ homeostasis in the cell (Shi and Zhu 2002). The AtNHX1 gene specific primers used in this study provided a 71.4% polymorphism rate, indicating the presence of a high level of allelic variation for AtNHX1 gene in common vetch. Transcriptional factor MtDREB1B (Arabidopsis thaliana Dehydration Responsive Element Binding factor 1B) gene encodes dehydration responsive element binding protein and is involved in plant responses to several abiotic stresses including salt tolerance (Donde et al. 2019). Up regulation of such transcription factors in plants increases proline content, which is one of the key molecules protecting plant cells in their responses to various abiotic stresses including salt (Dar et al. 2016). The results of this study revealed that AtDREB1B gene primers have a higher polymorphism rate (75%) along with the genes related to proline biosynthesis, namely delta1 pyroline-5-carboxylate synthase genes AtP5CS (75%) and MtP5CS (77.8%) than MtProDH (M. truncatula proline dehydrogenase) gene primers which had 33.3% polymorphism rate (Bouazzi et al. 2019). On the other hand, MtActin gene is generally used as control in transcription analysis due to its lower level of variation than other constitutive genes under various stress conditions including salt (Zhang et al. 2019). The results of this study showed that MtActin gene primers had a relatively low polymorphism rate (25%) in common vetch compared to the other gene specific primers tested, suggesting that a low level of variation of MtActin gene in common vetch should be considered when this gene is used as a housekeeping gene in RT-qPCR analysis.

The first three components of PCA analysis explained 57.63% of total variation and the cultivars Alınoglu and Farukbey separated from the rest of the cultivars while the cultivars Ayaz and Yucel were determined as the most distant cultivars (Figs 4 and5). The UPGMA analysis provided three main clades (Figs 4 and5). Of those, clade III included 5 cultivars and four of them (Urkmez, Alper, Ozveren and Yucel) were determined to be salt tolerant at germination stage while cultivar Zemheri in the same clade was determined to be salt sensitive. Clade II also included both salt tolerant and sensitive cultivars while clade I contained 2 salt sensitive cultivars only (Figs 4 and5). It was previously hypothesized that alternative oxidase (AOX) gene can be used as a functional marker under stress conditions (Arnholdt-Schmitt et al. 2006). Recent advances in current genome sequencing technologies and gene expression studies also resulted in the identification of a large number of functional genes involved in controlling agronomic traits including salt tolerance (Arnholdt-Schmitt 2005) and opened a new era in which those complete or partial gene sequences as molecular markers can be employed. As a result of these efforts, CAAT box derived polymorphism (CBDP) and start codon targeted (SCoT) polymorphism become important types of molecular markers in plant genome analysis (Sharma et al. 2019). In this study, we have used the primers for salt tolerance related genes as GTFMs to reveal genetic relationship as well as to determine the possibility of those gene primers to evaluate salt tolerance levels of the common vetch cultivars. The results revealed that salt tolerance-related GTFMs did not clearly distinguish the salt tolerant and sensitive common vetch cultivars defined in germination stage at 250 mM NaCl although the same markers were successfully able to determine the genetic relationships among the cultivars (Figs 4 and5). One of the reasons for such discrepancies may be due to gene primers indirectly related to salt tolerance being used in the study such as DREB1B, ProDH and P5CS genes along with MtActin gene. Another reason may come from the trait of salt tolerance per se which is a polygenic trait influenced by other environmental stimuli including drought stress, and its signaling cross talk with other important functional genes in various stages of plant growth and development. These findings suggested that a better clustering in terms of salt tolerance levels of the cultivars might be obtained if more specific gene markers associated with salt tolerance are used. However, some other genes which have a cross talk in response to salt tolerance in plants should also be considered to have a better resolution in such analysis. Overall, the results of this study demonstrate that gene specific primers related to salt tolerance in plants could be used to discriminate the salt tolerant and salt sensitive cultivars at germination stage as well as to determine intraspecific genetic diversity if a higher number of salt tolerance related genes are used as GTFMs. However, further studies should be conducted to test the reliability and reproducibility of GTFMs and their relation to not only salt tolerance but also to other abiotic stresses at various plant growth and development stages in various plant species.

Acknowledgments

This research is funded by Canakkale Onsekiz Mart University (COMU, BAP Grant #: FYL-2017-1156).

Author Contribution Statements

I.T. conceived the idea, granted financial support, planned the experiments, processed the experimental data, performed the analysis, performed all the numerical calculations, interpreted the data, designed the figures and table, drafted the manuscript. N.I. carried out the experiments.

References

 

Akhtar, P.; Hussain, F. 2009: Growth performance of Vicia sativa L under saline conditions. Pakistan Journal of Botany 41, 3075- 3080.

 

Arnholdt-Schmitt, B. 2005: Functional markers and a 'systemic strategy': convergency between plant breeding, plant nutrition and molecular biology. Plant Physiology and Biochemistry 43, 817- 820.

 

Arnholdt-Schmitt, B.; Costa, J.H.; de Melo, D.F. 2006: AOX--a functional marker for efficient cell reprogramming under stress? Trends Plant Science 11, 281- 287.

 

Babic, V.; Nikolic, A.; Andjelkovic, V.; Kovacevic, D.; Filipovic, M.; Vasic, V.; Mladenovic-Drinic, S. 2016: UPOV morphological versus molecular markers for maize inbred lines variability determination. Chilean Journal of Agricultural Research 76, 417- 426.

 

Bilgili, U.; Carpici, E.B.; Asik, B.B.; Celik, N. 2011: Root and shoot response of common vetch (Vicia sativa L ), forage pea (Pisum sativum L ) and canola (Brassica napus L ) to salt stress during early seedling growth stages. Turkish Journal of Field Crops 16, 33- 38.

 

Bouazzi, H.; Feki, K.; Brini, F.; Saibi, W. 2019: Is duality between proline metabolic mutation (p5cs 1-4) and durum wheat dehydrin transgenic contexts a "pacemaker" for salt tolerance process in Arabidopsis thaliana? Acta Physiologiae Plantarum 41(36), 1- 10.

 

Bu, Y.; Kou, J.; Sun, B.; Takano, T.; Liu, S. 2015: Adverse effect of urease on salt stress during seed germination in Arabidopsis thaliana. FEBS Letters 589, 1308- 1313.

 

Chai, X.; Dong, R.; Liu, W.X.; Wang, Y.R.; Liu, Z.P. 2017: Optimizing sample size to assess the genetic diversity in common vetch (Vicia sativa L ) populations using start codon targeted (SCoT) markers. Molecules 22, 1- 10.

 

Cil, A.; Tiryaki, I. 2016: Sequence-related amplified polymorphism and inter-simple sequence repeat marker-based genetic diversity and nuclear DNA content variation in common vetch (Vicia sativa L ). Plant Genetic Resources-Characterization and Utilization 14, 183- 191.

 

Dar, M.I.; Naikoo , M.I.; Rehman , F.; Naushin , F.; Khan, F.A. 2016: Proline accumulation in plants: roles in stress tolerance and plant development. In: Iqbal, N. (ed.), Osmolytes and plants acclimation to changing environment: emerging omics technologies, 155 Springer, New Delhi.

 

De la Rosa, L.; Zambrana, E.; Ramirez-Parra, E. 2020: Molecular bases for drought tolerance in common vetch: designing new molecular breeding tools. BMC Plant Biology 20, 71.

 

Dice, L.R. 1945: Measures of the amount of ecological association between species. Ecology 26, 297- 307.

 

Donde, R.; Gupta, M.K.; Gouda, G.; Kumar, J.; Vadde, R.; Sahoo, K.K.; Dash, S.K.; Behera, L. 2019: Computational characterization of structural and functional roles of DREB1A, DREB1B and DREB1C in enhancing cold tolerance in rice plant. Amino Acids 51, 839- 853.

 

El-Bok, S.; Zoghlami-Khelil, A.; Dougari, R.; Jabri, C.; Lamine, O.; El-Gazzah, M. 2015: Vicia sativa subsp sativa (Fabaceae): New taxonomic division in tunisia based on karyological data. Pakistan Journal of Agricultural Sciences 52, 279- 283.

 

Ertekin, İ.; Yılmaz, Ş.; Atak, M.; Can, E. 2018: Effects of different salt concentrations on the germination properties of hungarian vetch (Vicia pannonica Crantz ) cultivars. Türk Tarım ve Doğa Bilimleri Dergisi 5, 175- 179.

 

Farooq, M.; Gogoi, N.; Hussain, M.; Barthaku, r.S.; Paul, S.; Bharadwaj, N.; Migdadi, H.M.; Alghamdi, S.S.; Siddique , K.H. 2017: Effects, tolerance mechanisms and management of salt stress in grain legumes. Plant Physiology and Biochemistry 118, 199- 217.

 

Firincioglu, H.K.; Tate, M.; Unal, S.; Dogruyol, L.; Ozcan, I. 2007: A selection strategy for low toxin vetches (Vicia sativa spp ). Turkish Journal of Agriculture and Forestry 31, 303- 311.

 

Hussain, N.; Sarwar, G.; Schmeisky, H.; Al-Rawahy, S.; Ahmad, A. 2010: Salinity and drought management in legume crops. In: Andrews, M.; Hodge, S.; Yadav, S.S.; Redden, R. (eds.), Climate change and management of cool season grain legume crops, 171- 191. Springer, London.

 

Kang, H.W.; Park, D.S.; Go, S.J.; Eun, M.Y. 2002: Fingerprinting of diverse genomes using PCR with universal rice primers generated from repetitive sequence of Korean weedy rice. Molecules and Cells 13, 281- 287.

 

Kartal, G.K.; Senbek, G.; Karaca, M.; Acikgoz, E. 2020: Hybridization studies in Vicia sativa complex. Euphytica 216, 29.

 

Khayamim, S.; Afshari, R.T.; Sadeghian, S.Y.; Poustini, K.; Rouzbeh, F.; Abbasi, Z. 2014 : Seed germination, plant establishment, and yield of sugar beet genotypes under salinity stress. Journal of Agricultural Science and Technology 16, 779- 790.

 

Lee, S.B.; Kim, J.H.; Yun, J.C. 2014: Availability of hairy vetch (Vicia villosa Roth) as leguminous green manure crops for organic rice cultivation in reclaimed saline land. In: Rahmann, G.; Aksoy, U. (eds.), Proceedings of the 4th ISOFAR Scientific Conference, 949- 952. Istanbul, Turkey. Thünen.

 

Liu, M.; Wang, T.Z.; Zhang, W.H. 2015: Sodium extrusion associated with enhanced expression of SOS1 underlies different salt tolerance between Medicago falcata and Medicago truncatula seedlings. Environmental and Experimental Botany 110, 46- 55.

 

Liu, Z.; Liu, P.; Luo, D.; Liu, W.X.; Wang, Y.R. 2014: Exploiting illumina sequencing for the development of 95 novel polymorphic EST-SSR markers in common vetch (Vicia sativa subsp sativa). Molecules 19, 5777- 5789.

 

Mel, V.C.; Bado, V.B.; Ndiaye, S.; Djaman, K.; Nati, D.A.B.; Manneh, B.; Futakuchi, K. 2019: Predicting rice yield under salinity stress using K/Na ratio variable in plant tissue. Communications in Soil Science and Plant Analysis 50, 1321- 1329.

 

Ologundudu, A.F.; Adelusi, A.A.; Akinwale, R.O. 2014: Effect of salt stress on germination and growth parameters of rice. Scientia Biologicae 6, 237- 243.

 

Planchet, E.; Verdu, I.; Delahaie, J.; Cukier, C.; Girard, C.; Morere-Le Paven, M.C.; Limami, A.M. 2014: Abscisic acid-induced nitric oxide and proline accumulation in independent pathways under water-deficit stress during seedling establishment in Medicago truncatula. Journal of Experimental Botany 65, 2161- 2170.

 

Poczai, P.; Hyvonen, J.; Taller, J.; Jahnke, G.; Kocsis, L. 2013a: Phylogenetic analyses of teleki grapevine rootstocks using three chloroplast DNA markers. Plant Molecular Biology Reporter 31, 371- 386.

 

Poczai, P.; Varga, I.; Laos, M.; Cseh, A.; Bell, N.; Valkonen, J.P.; Hyvonen, J. 2013b: Advances in plant gene-targeted and functional markers: a review. Plant Methods 9, 6.

 

Powell, W.; Morgante, M.; Doyle, J.J.; McNicol, J.W.; Tingey, S.V.; Rafalski, A.J. 1996: Genepool variation in genus Glycine subgenus Soja revealed by polymorphic nuclear and chloroplast microsatellites. Genetics 144, 793- 803.

 

Quan, W.; Liu, X.; Wang, H.; Chan, Z. 2016: Comparative physiological and transcriptional analyses of two contrasting drought tolerant alfalfa varieties. Frontiers in Plant Science 6, 1256.

 

Raveendar, S.; Lee, G.A.; Jeon, Y.A.; Lee, Y.J.; Lee, J.R.; Cho, G.T.; Cho, J.H.; Park, J.H.; Ma, K.H.; Chung, J.W. 2015: Cross-Amplification of Vicia sativa subsp sativa microsatellites across 22 other Vicia species. Molecules 20, 1543- 1550.

 

SAS, I., 1997: SAS/STAT software: Changes and enhancements through release 6.12., SAS Institute, Cary, North Caroline.

 

Sharma, U.; Rai, M.K.; Shekhawat, N.S.; Kataria, V. 2019: Genetic homogeneity revealed in micropropagated Bauhinia racemosa Lam using gene targeted markers CBDP and SCoT. Physiology and Molecular Biology of Plants 25, 581- 588.

 

Sherasia, P.L.; Garg, M.R.; Bhanderi, B.M. 2017: Pulses and their by-products as animal feed. In: Calles, T.; Makkar, H. P. S. (eds.), Food and Agriculture Organization of the United Nations, Rome.

 

Shi, H.; Ishitani, M.; Kim, C.; Zhu, J.K. 2000: The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proceeding of the National Academy of Science USA 97, 6896- 6901.

 

Shi, H.; Zhu, J.K. 2002: Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. Plant Molecular Biology 50, 543- 550.

 

Shokat, S.; Großkinsky, D.K. 2019: Tackling salinity in sustainable agriculture-what developing countries may learn from approaches of the developed world. Sustainability 11, 4558.

 

Tiryaki, I.; Andrews, D.J. 2001: Germination and seedling cold tolerance in sorghum: I Evaluation of rapid screening methods. Agronomy Journal 93, 1386- 1391.

 

Tiryaki, I.; Kaplan, S.A. 2019: Enhanced germination performance of dormant seeds of Eragrostis tef in the presence of light. Tropical Grasslands-Forrajes Tropicales 7, 244- 251.

 

Wan, Q.H.; Wu, H.; Fujihara, T.; Fang, S.G. 2004: Which genetic marker for which conservation genetics issue? Electrophoresis 25, 2165- 2176.

 

Wang, J.W.; Yang, F.P.; Chen, X.Q.; Liang, R.Q.; Zhang, L.Q.; Geng, D.M.; Zhang, X.D.; Song, Y.Z.; Zhang, G.S. 2006: Induced expression of DREB transcriptional factor and study on its physiological effects of drought tolerance in transgenic wheat. Acta Genetica Sinica 33, 468- 476.

 

Yamada, M.; Morishita, H.; Urano, K.; Shiozaki, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Yoshiba, Y. 2005: Effects of free proline accumulation in petunias under drought stress. Journal of Experimental Botany 56, 1975- 1981.

 

Yokoi, S.; Quintero, F.J.; Cubero, B.; Ruiz, M.T.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. 2002: Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant Journal 30, 529- 539.

 

Zhang, X.X.; Han, L.B.; Wang, Q.; Zhang, C.; Yu, Y.J.; Tian, J.; Kong, Z.S. 2019: The host actin cytoskeleton channels rhizobia release and facilitates symbiosome accommodation during nodulation in Medicago truncatula. New Phytologist 221, 1049- 1059.


This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.