hrcak mascot   Srce   HID

Prethodno priopćenje
https://doi.org/10.15644/asc48/3/5

Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom

Renata Cimões   ORCID icon orcid.org/0000-0003-3673-8739 ; Federalno sveučilište Pernambuco, Recife, Brazil
Rafael Rafael Amorim Cavalcanti de Siqueira ; Federalno sveučilište Pernambuco, Recife, Brazil
Sergio Crovella ; Federalno sveučilište Pernambuco, Recife, Brazil
Paulo Roberto Eleutério de Souza ; Federalno sveučilište Pernambuco, Recife, Brazil
Nikos Donos ; Zavod za parodontologiju Eastmanova stomatološkog instituta, London, Ujedinjeno Kraljevstvo

Puni tekst: hrvatski, pdf (279 KB) str. 208-215 preuzimanja: 221* citiraj
APA 6th Edition
Cimões, R., Siqueira, R.R.A.C.d., Crovella, S., Souza, P.R.E.d. i Donos, N. (2014). Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom. Acta stomatologica Croatica, 48 (3), 208-215. https://doi.org/10.15644/asc48/3/5
MLA 8th Edition
Cimões, Renata, et al. "Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom." Acta stomatologica Croatica, vol. 48, br. 3, 2014, str. 208-215. https://doi.org/10.15644/asc48/3/5. Citirano 27.09.2020.
Chicago 17th Edition
Cimões, Renata, Rafael Rafael Amorim Cavalcanti de Siqueira, Sergio Crovella, Paulo Roberto Eleutério de Souza i Nikos Donos. "Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom." Acta stomatologica Croatica 48, br. 3 (2014): 208-215. https://doi.org/10.15644/asc48/3/5
Harvard
Cimões, R., et al. (2014). 'Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom', Acta stomatologica Croatica, 48(3), str. 208-215. https://doi.org/10.15644/asc48/3/5
Vancouver
Cimões R, Siqueira RRACd, Crovella S, Souza PREd, Donos N. Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom. Acta stomatologica Croatica [Internet]. 2014 [pristupljeno 27.09.2020.];48(3):208-215. https://doi.org/10.15644/asc48/3/5
IEEE
R. Cimões, R.R.A.C.d. Siqueira, S. Crovella, P.R.E.d. Souza i N. Donos, "Brza metoda za genotipiziranje DEFB1 - 44C/G SNP-a kod brazilskih pacijenata s parodontitisom", Acta stomatologica Croatica, vol.48, br. 3, str. 208-215, 2014. [Online]. https://doi.org/10.15644/asc48/3/5
Puni tekst: engleski, pdf (279 KB) str. 208-215 preuzimanja: 195* citiraj
APA 6th Edition
Cimões, R., Siqueira, R.R.A.C.d., Crovella, S., Souza, P.R.E.d. i Donos, N. (2014). A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis. Acta stomatologica Croatica, 48 (3), 208-215. https://doi.org/10.15644/asc48/3/5
MLA 8th Edition
Cimões, Renata, et al. "A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis." Acta stomatologica Croatica, vol. 48, br. 3, 2014, str. 208-215. https://doi.org/10.15644/asc48/3/5. Citirano 27.09.2020.
Chicago 17th Edition
Cimões, Renata, Rafael Rafael Amorim Cavalcanti de Siqueira, Sergio Crovella, Paulo Roberto Eleutério de Souza i Nikos Donos. "A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis." Acta stomatologica Croatica 48, br. 3 (2014): 208-215. https://doi.org/10.15644/asc48/3/5
Harvard
Cimões, R., et al. (2014). 'A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis', Acta stomatologica Croatica, 48(3), str. 208-215. https://doi.org/10.15644/asc48/3/5
Vancouver
Cimões R, Siqueira RRACd, Crovella S, Souza PREd, Donos N. A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis. Acta stomatologica Croatica [Internet]. 2014 [pristupljeno 27.09.2020.];48(3):208-215. https://doi.org/10.15644/asc48/3/5
IEEE
R. Cimões, R.R.A.C.d. Siqueira, S. Crovella, P.R.E.d. Souza i N. Donos, "A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis", Acta stomatologica Croatica, vol.48, br. 3, str. 208-215, 2014. [Online]. https://doi.org/10.15644/asc48/3/5

Rad u XML formatu

Sažetak
Svrha: Defensini su kationski antimikrobni peptidi koji se pojavljuju u epitelnim stanicama. Imaju antimikrobna, antifungalna i antivirusna svojstva te su prirođena komponenta imunosnog odgovora. Jedna od hipoteza jest da peptidi štite usnu šupljinu. U ovom istraživanju procijenili smo polimorfizam gena DEFB1 kod dijabetičara s parodontitisom ili bez njega i rezultate usporedili sa zdravom kontrolnom skupinom. Materijali i metode: Koristili smo se testom Hairpin-Shaped Primer (HP) kako bismo istražili rasprostranjenost - 44 C/G SNP-a (rsl1800972) u 119 uzoraka ljudske DNK dobivene od dijabetičara i zdravih pacijenata. Rezultati: Rezultati su pokazali da između grupa nema razlika u rasprostranjenosti, te da je kod dijabetičara s parodontitisom češći homozigotni mutant. Zaključak: Potrebna su daljnja istraživanja kako bi se otkrila uloga polimorfizma DEFB1 kod dijabetičara s parodontitisom te utjecaj peptida na parodontne patogene.

Ključne riječi
defenzini; kationski antimikrobni peptidi; DEFB1 bjelančevina, humana; epitelne stanice; dijabetes, komplikacije; parodontitis

Hrčak ID: 127324

URI
https://hrcak.srce.hr/127324

▼ Article Information



INTRODUCTION

Human beta-defensins (hBD) are a family of small peptides, encoded by a gene cluster located on human chromosome 8p22-23 (1), exhibit a broad spectrum of antimicrobial activity against Gram-positive and Gram-negative bacteria, fungi and viruses. The antimicrobial action is postulated to be a disruption of the microbial membrane by pore formation (2). β-defensins are part of the innate immune system and act as the first line of human defence (3) and are primarily expressed by epithelial cells of the skin, kidneys and trachea-bronquial. β-defensins are released upon microbial invasion and are located at the host environment interface, such as mucosa and skin (4). Within β-defensins the human beta defensin 1 (hBD-1) is also known to play a direct role on inflammation pathway (5). In addition to their broad spectrum antimicrobial properties, there is evidence that hBD-1 act as chemokine for immature dendritic cells and memory T cells, and thus may serve as an important bridge between the innate and adaptive immune systems (6).

Single nucleotide polymorphisms (SNPs) are the most abundant form of genetic variation between individuals; some have been observed to cause several diseases (7) and have been proven to be useful tools for identifying genes involved in common polygenic and multifactorial diseases (8). Moreover, they are useful in understanding the pathogenesis of several diseases (9). Three SNPs localized at positions -52G>A (rs1799946), -44C>G (rs1800972), and -20G>A (rs11362) in the 5’ untranslated region (UTR) of DEFB1 gene have been reported to promote the same functional alteration of the hBD-1 expression in different cellular models (10, 11).

The C→G transversion at position -44 of the 5’ un-translated (UTR) region DEFB1 gene (which encodes human β-defensin 1) has been associated with Candida sp. carriage in the mouth (12) and with the risk of human immunodeficiency virus type 1 infection in the Caucasian population (1). However, there has not been an established association for two different ethnic groups for early-onset periodontal disease, Caucasian and African-Americans (9). The three 5’UTR DEFB1 gene SNPs exhibit differences in frequency between ethnic groups (12).

Periodontitis is a chronic inflammatory disease that affects the supporting tissues of the teeth (13) and has it been reported to be the sixth classic complication of the diabetic patient (14). It is generally accepted that the presence of bacteria is a necessary but not sufficient condition for the development of periodontitis. Host immune responses, genetic and environmental factors determine part of the susceptibility and severity of periodontitis (15). The development of periodontal disease seems to be determined by the relationship between the periodontopathogenic potential of the plaque and the immune response of the host (16).

Considering that the immune system plays a crucial role in the pathogenesis of periodontitis, the aim of this study was to analyze the presence of DEFB1 gene polymorphism in codon -44 C/G in a Brazilian patient sample with type 2 diabetes mellitus with and without chronic periodontitis compared with systemically and periodontally healthy patients.

Material and Methods

Study Population

This study is a case control design with a total of 118 participants. Eighty-four cases of type 2 diabetic patients were enrolled and followed up at the Department of Endocrinology of the Federal University of Pernambuco Hospital. Thirty-four unmatched healthy control patients were also enrolled. Free and informed written consent had been obtained from all patients. The research project was approved by the Ethics in Research Committee of the Federal University of Pernambuco.

Inclusion criteria for diabetic patients were: diagnosis of type 2 diabetes; having at least eight natural teeth. Exclusion criteria were: have used antibiotics for the last six months; have undergone periodontal treatment for the last six months, being pregnant or breastfeeding. Inclusion criteria for controls: no history of periodontitis, absence of any ≥ 3mm clinical attachment loss (CAL); absence of any ≥ 4mm probing pocket depth (PPD), no history of diabetes. All patients have registered socioeconomic data and underwent a clinical examination using a millimeter North Carolina-type periodontal probe (Trinity®, Brazil). Six sites per tooth were evaluated for PPD, BOP, CAL. Periodontal disease was defined as four or more sites with a loss of attachment of 5mm or more with one or more of those sites having a pocket of 4mm or more (17).

DNA extraction and Genotyping

After clinical examination, the collection of scaling cells from the oral mucosa was carried out with appropriate cytobrush-type brushes (Kolplast®, Sao Paulo, Brazil), which were subsequently stored in 1 ml of saline solution of 0.9% chloride sodium (Laboratory Tayuyna, Ltda – Nova Odessa, Sao Paulo, Brazil), the collected material was stored at -20ºC for DNA extraction and performed with Geneclean® (GeneClean® kit, Bio 101, La Jolla, CA, USA) kit following manufacturer’s protocols.

The detection of polymorphism in position -44 C/G of 5’UTR region of DEFB1 was conducted by the technique Q-PCR and hairpin-shaped primer (HP). Sequences of the forward C- and G- allele specific HPs were: GGCTGGACCTCCAATGGAGCCAGCC (wild template) and CGCTGGACCTCCAATGGAGCCAGCG (mutant template), respectively. The common reverse primer was: CAGGATTTCAGGAACTGGGGAG, the length of amplicon was 45-bp. For each DNA sample two real-time PCRs of 25μl were run in parallel, one with C-allele-specific HP and the other with the G-allele-specific HP. Each reaction contained 12.5 μl SYBR Green PCR Master Mix 1X (LGC, Biotechnology, Australia), 1μM of each primer, 10ng of template DNA. All PCRs were run in a Rotor-Gene Q real-time PCR instrument (Qiagen, Cologne, Germany), thermal cycling conditions were divided in three stages as follows: stage 1 – 95o. C for 10 min, 70o.C for 30s; stage 2 – 72o.C for 30s, 95o.C for 20s, 69o.C for 30s lowering 1o.C each cycle for 10 cycles; stage 3 – 72o.C for 30s, 95o.C for 20s, 60o.C for 30s for 40 cycles. Data were collected in the last step of stage 3 in order to calculate the Ct of each amplification curve. This methodology was previously described (9).

Statistical Analysis

The confidence interval considered was 95%, so p-values less than 0.05 were accepted. The results which did not attain this value were considered to be without significance. All data analyses were performed using the statistical package SPSS version 13.0 (SPSS Inc., Chicago, IL, USA).

RESULTS

The mean age of the patients was 45.5 (18 – 82) years, 68.9% being female. The mean CAL of the diabetic patients group was 3.44mm, median 3.08mm and standard deviation of 1.45mm.

For the HP assay, the three possible genotypes were identified in a Brazilian sample of 119 patients; Figure 1 shows that the HP assays allows a clear discrimination of the three different genotypes, using human DNA.

Figure 1 A, B, C HP assay for detection of the -44 DEFB1 SNP. Genotypes C/C, C/G and G/G respectively, in the sample evaluated.
ASC_48(3)_208-215-f1__A__B__C

Regarding the distribution of genotypes, the sample presented 68 (57.1%) subjects with C/C, 39 (32.8%) C/G and 12 (10.1%) G/G. There were no significant differences between diabetic with or without periodontitis and healthy controls (Table 1). The genotype homozygous mutant was more frequently found in diabetic patients with periodontitis.

Table 1 Genotypes frequencies in DEFB1 gene in a Brazilian diabetic population and healthy controls.
Genotypes
PatientsP value*
Diabetic patients
Healthy controls

Periodontitis
%
Without periodontitis
%
%

C / C
C / G
G / G
50.0 (22/44)
34.1(15/44)
15.9 (7/44)
68.3 (28/41)
29.3 (12/41)
2.4 (1/41)
53.0 (18/34)
35.3 (12/34)
11.7 (4/34)
=0.232

* Chi-Square test, significance level at 5%, confidence level at 95%

The allele frequency is shown in Table 2. The allele mutant G was more frequently found in the diabetic periodontitis group. Considering allele frequencies there were no significant differences among the groups.

Table 2 Frequencies of the alleles -44 DEFB1 gene in a Brazilian diabetic population and healthy controls.
Allele
Patients
Diabetic
Healthy Controls
n (%)
Periodontitis
n (%)
Without periodontitis
n (%)
C
G
67.0 (59/88)
33.0 (29/88)
83.0 (68/82)
17.0 (14/82)
70.6 (48/68)
29.4 (20/68)

When considering the mean CAL in diabetic patients and healthy controls in relation to genotypes, no differences were established (p=0.49). Among the three groups, a higher percentage of the genotype C/C was found; in the group with diabetes and periodontitis the percentages between homozygous (C/C) and heterozygous (C/G) were similar (Figure 2).

Figure 2 Allele frequency.
ASC_48(3)_208-215-f2

DISCUSSION

In the present study the HP assay was used to evaluate the polymorphism in codon -44 DEFB1 gene in a sample of diabetic Brazilian adult population in comparison with healthy controls. This method allowed distinguishing the three possible genotypes in the sample. Through amplification curve it was possible to identify the genotype in each patient. Samples which showed an earlier Ct with C HP were considered allele C homozygous, samples that had an earlier Ct with G HP were considered allele G homozygous and heterozygous samples showed similar Cts in both reactions.

The technique was simple, feasible, and previous authors reported that HPs increase the specificity and the sensitivity of PCRs assay (9, 18). Other authors used different techniques such as PCR-RFLP (19-21), real time PCR and probes (21) to evaluate the SNP in DEFB1 gene. In these methods manipulation after the PCR run is needed, and the superiority of the primers used in HP assay, over conventional linear primers for SNP detection, has previously been demonstrated (22).

The β-defensins are a family of antimicrobial peptides that have been implicated in the innate host defence system. Genetic variation in genes DEFB1 may underline changes in expression or configuration of the peptide. Such changes may be associated with alteration in innate response to pathologic challenge and may also result in susceptibility or resistance to certain types of infections (2). The association of DEFB1 -44C/G polymorphism in a Brazilian diabetic population with or without periodontitis in comparison to healthy control patients was evaluated in the study and no differences were observed among groups. The healthy control group exhibited a higher percentage of genotype homozygous wild (C/C), while the diabetic periodontitis group exhibited higher percentages of homozygous mutant (G/G) when compared to the other groups.

The genetic variability may cause differences in frequency of genotypes, alleles and, consequently, changes in host response according to ethnicity (12), but Jurevic et al. (2) have shown no differences considering ethnics in relation to SNP in site -44 of DEFB1 gene.

DEFB1 -44C/G polymorphism has been associated with many pathologic conditions such as chronic obstructive pulmonary disease, Candida carriage in the mouth (23), risk of human immunodeficiency virus type 1 in the Caucasian population (24), sepsis (25), Crohn´s disease (12), atopic dermatitis (26), lepromatous leprosy (21) and diabetes (3). A small number of studies have been made targeting DEFB1 polymorphism considering periodontal conditions, such as Boniotto et al. (9) that evaluated SNP of DEFB1 gene and periodontitis using HP assay. The present study is the first report of the application of a HP assay to SNP genotyping in a diabetic population with or without periodontitis and healthy controls.

Considering the total patient sample, the results of the present research, regarding genotypes, are in agreement with Boniotto et al. (9) but it disagrees with some previous researches (3, 24, 25, 27). In relation to alleles frequencies this research shows a higher percentage of G allele than others (2, 3, 9, 23-25, 27). This finding could be explained by ethnic differences that may influence the frequency and distribution of the SNP considering the sample was constituted by a Northeast Brazilian population, and a few studies have been made in such population to evaluate genetic factors interference in periodontal disease (16). In a previous study, Jurevic et al. (23) tried to demonstrate that G allele was associated with protective effect in diabetic patients in relation to Candida carriage, but no significant differences were found between diabetic and non-diabetic populations. The diabetic periodontitis group exhibited the most frequencies of genotype and allele mutant.

The lack of significant differences may be explained by the fact that human beta-defensin 1 is not active against periodontal bacteria and does not play a role in periodontal disease. Previous studies demonstrated that Treponemas may serve as a physical barrier protection between epithelium derived antimicrobial peptides and other defensins-sensitive bacteria involved in periodontal disease, contributing to the survival of these and other bacteria in the gingival crevice (28, 29). And also that Treponema denticola is resistant to peptide β-defensin-1 (29). Nevertheless, no data are available regarding the biological activity of this peptide against Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, viruses and other microorganisms implicated in the pathogenesis of the periodontal disease.

CONCLUSION

In conclusion, the presence of SNP DEFB1 was evaluated in diabetic patients with or without periodontitis in comparison to healthy controls, being the first report investigating a possible association between DEFB1 in diabetic patients in relation to their periodontal condition. No significant differences were found and further studies should be performed in order to elucidate the role of DEFB1 polymorphisms in relation to periodontal disease, mainly its biological activity against the microorganisms involved in periodontitis.

REFERENCES

1 

Jia HP, Schutte BC, Schudy A, Linzmeier R, Guthmiller JM, Johnson GK, et al. Discovery of new human beta-defensins using a genomics based approach. Gene. 2001 Jan 24;263(1-2):211–8. DOI: http://dx.doi.org/10.1016/S0378-1119(00)00569-2 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11223260

2 

Jurevic RJ, Chrisman P, Mancl L, Livingston R, Dale BA. Single-nucleotide polymorphisms and haplotype analysis in beta-defensin genes in different ethnic populations. Genet Test. 2002 Winter;6(4):261–9. DOI: http://dx.doi.org/10.1089/10906570260471787 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12537649

3 

Guimaraes RL, Segat L, Rocha CR, Brandao LA, Araujo J, Naslavsky MS, et al. Functional polymorphisms of DEFB1 gene in type 1 diabetes Brazilian children. Autoimmunity. 2009 Aug;42(5):406–13. DOI: http://dx.doi.org/10.1080/08916930902882756 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19811257

4 

Travis SM, Singh PK, Welsh MJ. Antimicrobial peptides and proteins in the innate defense of the airway surface. Curr Opin Immunol. 2001 Feb;13(1):89–95. DOI: http://dx.doi.org/10.1016/S0952-7915(00)00187-4 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11154923

5 

Oppenheim JJ, Biragyn A, Kwak LW, Yang D. Roles of antimicrobial peptides such as defensins in innate and adaptive immunity. Ann Rheum Dis. 2003 Nov;62 Suppl 2:ii17–21. DOI: http://dx.doi.org/10.1136/ard.62.suppl_2.ii17 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/14532141

6 

Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, Shogan J, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science. 1999 Oct 15;286(5439):525–8. DOI: http://dx.doi.org/10.1126/science.286.5439.525 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/10521347

7 

Waterfall CM, Cobb BD. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis. Nucleic Acids Res. 2001 Dec 1;29(23):119e. DOI: http://dx.doi.org/10.1093/nar/29.23.e119 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11726702

8 

Gray IC, Campbell DA, Spurrm NK. Single nucleotide polymorphisms as tools in human genetics. Hum Mol Genet. 2000 Oct;9(16):2403–8. DOI: http://dx.doi.org/10.1093/hmg/9.16.2403 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11005795

9 

Boniotto M, Hazbon MH, Jordan WJ, Lennon PG, Eskadale J, Alland D, et al. Novel Hairpin-shaped Primer assay to estudy the association of the -44 single-nucleotide polymorphism of the DEFB1 gene with early- onset periodontal disease. Clin Diagn Lab Immunol. 2004 Jul;11(4):766–9. PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15242954

10 

Sun CQ, Arnold R, Fernandez-Golarz C, Parrish AB, Almekinder T, He J, et al. Human beta-defensin-1, a potential chromosome 8p tumor suppressor: Control of transcription and induction of apoptosis in renal cell carcinoma. Cancer Res. 2006 Sep 1;66(17):8542–9. DOI: http://dx.doi.org/10.1158/0008-5472.CAN-06-0294 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16951166

11 

Milanese M, Segat L, Crovella S. Transcriptional effect of DEFB1 gene 5′ untranslated region polymorphisms. Cancer Res. 2007 Jun 15;67(4):395–8. PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17575171

12 

Kocsis AK, Lakatos PL, Somogyyari F, Fuszek P, Papp J, Fischer S, et al. Association of beta-defensin 1 single nucleotide polymorphisms with Crohn's disease. Scand J Gastroenterol. 2008 Mar;43(3):299–307. DOI: http://dx.doi.org/10.1080/00365520701682615 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18938660

13 

Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL Jr. Microbial complexes in subgingival plaque. J Clin Periodontol. 1998 Feb;25(2):134–44. DOI: http://dx.doi.org/10.1111/j.1600-051X.1998.tb02419.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9495612

14 

Lim LP, Tay FB, Sum CF, Thai AC. Relationship between markers of metabolic control and inflammation on severity of periodontal disease in patients with diabetes mellitus. J Clin Periodontol. 2007 Feb;34(2):118–23. DOI: http://dx.doi.org/10.1111/j.1600-051X.2006.01032.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17309586

15 

Kinane DF, Peterson M, Stathopoulou PG. Environmental and other modifying factors of the periodontal diseases. Periodontol 2000. 2006;40:107–19. DOI: http://dx.doi.org/10.1111/j.1600-0757.2005.00136.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16398688

16 

Araújo NC, Bello DMA, Souza PRE, Cimões R. Association of polymorphism MBL2 gene in type 2 diabetic patients with periodontitis: a preliminary study. Acta Stomatol Croat. 2009;43:290–300.

17 

Beck JD, Koch GG, Rozier RG, Tudor GE. Prevalence and risk indicators for periodontal attachment loss in a population of older community-dwelling blacks and whites. J Periodontol. 1990 Aug;61(8):521–8. DOI: http://dx.doi.org/10.1902/jop.1990.61.8.521 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/2391631

18 

Kaboev OK, Luchkina LA, Tret’iakov AN, Bahrmand AR. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure). Nucleic Acids Res. 2000 Nov 1;28(21):94e. DOI: http://dx.doi.org/10.1093/nar/28.21.e94 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11058144

19 

Dörk T, Stuhrmann M. Polymorphisms of the human beta-defensin-1 gene. Mol Cell Probes. 1998 Jun;12(3):171–3. DOI: http://dx.doi.org/10.1006/mcpr.1998.0165 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9664579

20 

Prado-Montes de Oca E, Rangel-Villalobos H, Gallegos-Arreola MP, Sandoval L, Figuera LE. SNPs in human beta-defensin 1 gene (DEFB1): frequencies in a Mexican population and new PCR-RFLPs assays. Int J Immunogenet. 2006;33:339–42. DOI: http://dx.doi.org/10.1111/j.1744-313X.2006.00628.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16984277

21 

Prado-Montes de Oca E, Velarde-Félix JS, Ríos-Tostado JJ, Picos-Cárdenas VJ, Figuera LE. SNP 668C (-44) alters a NF-kappaB1 putative binding site in non-coding strand of human beta-defensin 1 (DEFB1) and is associated with lepromatous leprosy. Int J Immunogenet. 2006 Oct;33(5):339–42. DOI: http://dx.doi.org/10.1111/j.1744-313X.2006.00628.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16984277

22 

Hazbon MH, Alland D. Hairpin primers for simplified singlenucleotide polymorphism analysis of Mycobacterium tuberculosis and other organisms. J Clin Microbiol. 2004 Mar;42(3):1236–42. DOI: http://dx.doi.org/10.1128/JCM.42.3.1236-1242.2004 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15004082

23 

Jurevic RJ, Bai M, Chadwick RB, White TC, Dale BA. Single-nucleotide polymorphisms (SNPs) in human beta-defensin 1: highthroughput SNP assays and association with Candida carriage in type I diabetics and nondiabetic controls. J Clin Microbiol. 2004 Mar;42(3):1236–42. PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15004082

24 

Braida L, Boniotto M, Pontillo A, Tovo PA, Amoroso A, Crovella S. A single-nucleotide polymorphism in the human beta-defensin 1 gene is associated with HIV-1 infection in Italian children. AIDS. 2004 Jul 23;18(11):1598–600. DOI: http://dx.doi.org/10.1097/01.aids.0000131363.82951.fb PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15238780

25 

Chen QX, Lv C, Huang LX, Cheng BL, Xie GH, Wu SJ, et al. Genomic variations within DEFB1 are associated with the susceptibility to and the fatal outcome of severe sepsis in Chinese Han population. Genes Immun. 2007 Jul;8(5):439–43. DOI: http://dx.doi.org/10.1038/sj.gene.6364401 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17508030

26 

Kim E, Lee JE, Namkung JH, Kim PS, Kim S, Shin ES, et al. Single nucleotide polymorphisms and the haplotype in the DEFB1 gene are associated with atopic dermatitis in a Korean population. J Dermatol Sci. 2009 Apr;54(1):25–30. DOI: http://dx.doi.org/10.1016/j.jdermsci.2008.12.005 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19135873

27 

Milanese M, Segat L, Pontillo A, Arraes LC, de Lima Filho JL, Crovella S. DEFB1 gene polymorphisms and increased risk of HIV-1 infection in Brazilian children. AIDS. 2006 Aug 1;20(12):1673–5. DOI: http://dx.doi.org/10.1097/01.aids.0000238417.05819.40 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16868452

28 

Brissette CA, Simonson LG, Lukehart SA. Resistance to human beta-defensins is common among oral treponemes. Oral Microbiol Immunol. 2004 Dec;19(6):403–7. DOI: http://dx.doi.org/10.1111/j.1399-302x.2004.00177.x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15491467

29 

Brissette CA. S. A. Lukehart SA. Treponema denticola is resistant to human beta-defensins. Infect Immun. 2002 Jul;70(7):3982–4. DOI: http://dx.doi.org/10.1128/IAI.70.7.3982-3984.2002 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12065549


This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.

[engleski]

Posjeta: 631 *