Introduction
During the past 25 years, only seven studies have been published about the diversity of marine macroalgae found around the Maltese islands, and these were entirely based on morphological identification (Borg et al. 1998,Lanfranco et al. 1999,Schembri et al. 2005,Evans et al. 2015,Bonnici et al. 2018,ERA 2020). Of all these studies, the only publication focusing solely on macroalgae was a checklist byCormaci et al. (1997), which reported ‘199 Rhodophyceae, 63 Fucophyceae and 57 Chlorophyceae’, making up a total of 319 macroalgal species in Malta. To date, no DNA studies have been conducted specifically to identify Maltese macroalgae, and indeed, few such studies have been carried out in the Mediterranean area as a whole (Bartolo et al. 2020).
Molecular tools have challenged the idea that marine species have wide geographical ranges. Instead, they have demonstrated that some marine macroalgal ‘species’ actually consist of several geographically restricted cryptic species, i.e. species which are classified as one due to a lack of or only few morphological differences (Payo et al. 2012). Broad distribution ranges of many algae can be attributed to pervasive cryptic diversity (Tronholm et al. 2012). Moreover, molecular assessment of the diversity of macroalgal species has demonstrated that morphological species identification underestimates the diversity in a given location (Payo et al. 2012,Vieira et al. 2017).
For the present study, substrata around the Maltese islands were sampled to reveal macroalgal biodiversity from cryptic life stages, including species with microscopic thalli. We used the germling emergence (GE) method in combination with DNA barcoding of the 5’-end of the mitochondrial cytochrome c oxidase subunit 1 gene (COI) and the plastid-encoded large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) markers to identify algal species. The study of macroalgal microstages and microscopic species in situ is a challenging task, which was overcome by the germination and isolation of microscopic algal stages and microscopic species in vitro. This GE method has shown a potential for increasing the biogeographic and taxonomic knowledge on macroalgae (Peters et al. 2015). In fact, here we present three macroalgal species that were previously unreported from the Maltese islands and confirm the presence of another three algal species.
Materials and methods
Substratum samples, including small pebbles and shell fragments, as well as Posidonia oceanic (Linnaeus) Delile and Padina pavonica (Linnaeus) Thivy fragments, were collected from four sites in the Maltese islands (Tab. 1).
Algal germlings were isolated from the substratum using the GE method (Peters et al. 2015), which involves the incubation of the substratum in a herbivore-free and nutrient-rich environment. The samples were cultured in 90 mm Petri dishes filled with 35 mL of Provasoli-enriched natural autoclaved seawater (Starr and Zeikus 1993,Coelho et al. 2012), incubated at 18 ºC and exposed to natural light. Clonal strains of filamentous algae were isolated after 1-3 months by cutting fragments of emerging algae under the stereomicroscope and transferring them into new dishes. Monoeukaryotic strains (Tab. 1) were obtained by sub-isolating few-celled thallus fragments.
The isolates were studied via light microscopy (Nikon Eclipse Ti-S inverted microscope connected to a Nikon Digital DS-Fi 1 camera). The keys inCormaci et al. (2012) were used for morphological identification of the species.
DNA was extracted from each specimen using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol modified with a CTAB pre-treatment according toGachon et al. (2009). The DNA was quantified using a Nanodrop 2000 spectrophotometer. Partial COI and rbcL genes, as well as the RuBisCO spacer, were amplified using the primer pairs listed inTab. 2.
| Biomarker | Primer name | Primer No. | Sequence | Reference |
|---|---|---|---|---|
| COI | GazF2 | 1 | CCAACCAYAAAGATATWGGTAC | Lane et al. 2007 |
| GazR2 | 2 | GGATGACCAAARAACCAAAA | Lane et al. 2007 | |
| DumR1 | 3 | AAAAAYCARAATAAATGTTGA | Saunders 2005 | |
| rbcL and RuBisCO spacer | rbcLP2F/ rbcL40DF | 4 | GAWCGRACTCGAWTWAAAAGTG | Kawai et al. 2007 |
| rbcS139R | 5 | AGACCCCATAATTCCCAATA | Peters and Ramírez 2001 | |
| rbcL | rbcL1273F | 6 | GTGCGACAGCTAACCGTG | Peters et al. 2010 |
| rbcS139R | 7 | As above | As above |
PCR amplifications were performed in a total volume of 50 μL, containing approximately 100 ng of DNA, a deoxynucleoside triphosphate mixture (0.2 mM each), supplemented to give a final concentration of 1.8 mM MgCl2, 0.625 U of OneTaq Quick Load 2× Master Mix with Standard Buffer (New England Biolabs, Inc.), 0.5 pmol of each primer and of 21 μL nuclease-free water.
Amplifications were carried out in a GeneAmp thermocycler PCR system 2700 (Applied Biosystems, Foster City, CA, USA) or T3000 thermocycler (Biometra, Jena, Germany) according to the PCR programmes listed inTab. 3. PCR products were verified on 1% (w/v) agarose gel. PCR products were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sequenced via a BigDye Terminator v3.1 Cycle Sequencing Kit on an ABI 3730xl DNA analyser (Applied Biosystems, Foster City, California, USA) at Eurofins Genomics (Germany).
| Primer pairs | Initial | Amplification | Final extension | Reference | |||
|---|---|---|---|---|---|---|---|
| Cycles | Denaturation | Annealing | Elongation | ||||
| 1 and 2 | 4 min at 94 °C | 38 | 1min at 94 °C | 30 s at 50 °C | 1min at 72 °C | 7 min at 72 °C | Lane et al. 2007 |
| 1 and 3 | 1min at 94 °C | 35 | 1min at 94 °C | 1.5 min at 50 °C | 1min at 72 °C | 5 min at 72 °C | Peña et al. 2015 |
| 4 and 5 | 3 min at 95 °C | 30 | 30 s at 95 °C | 30 s at 55 °C | 2 min at 72 °C | 7 min at 72 °C | Muñoz 2016 |
| 6 and 7 | 3 min at 95 °C | 30 | 30 s at 95 °C | 30 s at 55 °C | 1 min at 72 °C | 7 min at 72 °C | Muñoz 2016 |
The sequences were manually checked for correctness by inspecting the chromatograms and were compared to published sequences by the Basic Local Alignment Search Tool (BLAST) housed at the United States National Center of Biotechnology Information (Zhang et al. 2000). The nucleotide sequences obtained during this study were deposited in the DDBJ/GenBankTM/EBI Data Bank and Accession numbers are listed inTab. 4.
The biomarkers obtained were then analysed to arrive at the taxonomic identity of the algae. Taxonomic identities of algae based on molecular studies are highly dependent on the correct identification of DNA sequences in molecular databases, the degree of representation of the species concerned, and the percentage identity between the sequences being compared. The resolving power as species-level cut-off used for COI in the Ectocarpales was 1.8% (Peters et al. 2015). This barcode gap, previously identified empirically byPeters et al. (2015), was confirmed to range from 0.011 to 0.037 K2P pair-wise genetic distance in Ectocarpus (Montecinos et al. 2017), i.e. the equivalent of 1.1% to 3.7%. In fact, for all COI sequences in this study the species-level cut-off applied was more conservative, at 0.6%. In the case of the rbcL gene, a more conservative approach was applied, taking into consideration that the rbcL is less variable (Camacho et al. 2019), with the highest species-level cut-off used being 0.4%. This ensured that all species and genera presented in this study were identified only to the level at which there is high-level confidence.
A literature review was also conducted on Google Scholar to provide an updated macroalgal species list for Malta. The following terms were combined in the search: (“Macroalgae” OR “marine algae” OR “seaweeds” OR “algae” OR “brown algae” OR “Phaeophyceae” OR “Rhodophyta” OR “Chlorophyta” OR “green algae” OR “red algae” OR “alien algae”) AND (“Maltese islands” OR “Malta” OR “Gozo” OR “Comino”). This resulted in seven publications (Cormaci et al. 1997,Borg et al. 1998,Lanfranco et al. 1999,Schembri et al. 2005,Evans et al. 2015,Bonnici et al. 2018,ERA 2020). Further searches were conducted using the ‘distribution’ feature on AlgaeBase (Guiry and Guiry 2020). Moreover, AlgaeBase (Guiry and Guiry 2020) was also used to update the species names in the compiled list to reflect revisions in taxonomy.
Results
In this paper, we report 14 sequences based on surveys in the Maltese islands using COI, rbcL and the RuBisCO spacer. The results include four COI, five rbcL and five RuBisCO spacer barcodes.Tab. 5 provides the results of the BLAST searches including the length of sequence, the percentage identity with the closest hits, as well as the percentage query cover. The BLAST searches resulted in five strains being identified up to species-level and one strain up to genus-level as follows: Schizocladia ischiensis E.C. Henry, K. Okuda et H. Kawai (Schizocladiophyceae), Hecatonema terminale (Kützing) Kylin, Striaria attenuata (Greville) Greville, Colpomenia sinuosa (Mertens ex Roth) Derbès et Solier, Asperococcus bullosus J.V.Lamouroux and Sphacelaria sp.
| Species name | Strain | Marker | Length (bp) | % Identity | % Cover | Accession | Species name and locality |
|---|---|---|---|---|---|---|---|
| Colpomenia sinuosa | MT17-059 | rbcL | 194 | 100 | 100 | AF385839 | Colpomenia sinuosa, Korea,Cho et al. 2001 |
| Colpomenia sinuosa | MT17- 059 | spacer | 189 | 97.4 | 100 | AF385839 | Colpomenia sinuosa, Korea,Cho et al. 2001 |
| Colpomenia sp. | MT17- 059 | COI | 538 | 97.3 | 95 | KF281125 | C. sinuosa, Australia,McDevit & Saunders, 2017 |
| Sphacelaria sp. | MT17- 026 | COI | 608 | 99.3 | 99 | LM994971 | Sphacelaria sp., Greece,Peters et al. 2015 |
| Hecatonema terminale | MT17- 068 | COI | 633 | 100 | 98 | LM995391 | H. maculans, Greece,Peters et al. 2015 |
| Hecatonema terminale | MT17- 068 | rbcL | 1403 | 99.9 | 100 | AF207802 | Hecatonema sp., unpublished |
| Hecatonema terminale | MT17- 068 | spacer | 207 | 99.5 | 99 | AF207802 | Hecatonema sp., unpublished |
| Schizocladia ischiensis | MT17- 100 | rbcL | 1006 | 99.8 | 100 | MN996275 | Schizocladia ischiensis, Italy,Rizouli et al. 2020 |
| Schizocladia ischiensis | MT17- 100 | spacer | 82 | 100 | 100 | MN996275 | Schizocladia ischiensis, Italy,Rizouli et al. 2020 |
| Striaria attenuata | MT17- 092 | rbcL | 194 | 100 | 100 | AF055415 | Striaria attenuata, Chile,Siemer et al. 1998 |
| Striaria attenuata | MT17- 092 | spacer | 181 | 98.3 | 100 | AF055415 | Striaria attenuata, Chile,Siemer et al. 1998 |
| Asperococcus bullosus | MT17- 099 | rbcL | 1427 | 99.6 | 96 | LC016509 | Asperococcus bullosus, Japan,Kawai et al. 2016 |
| Asperococcus bullosus | MT17- 099 | spacer | 178 | 91.2 | 100 | AY095321 | Asperococcus fistulosus, UK,Cho et al. 2003 |
| Asperococcus bullosus | MT17- 099 | COI | 625 | 99.8 | 99 | MN184505 | A. bullosus, Norway,Bringloe et al. 2019 |
Schizocladia ischiensis is the only taxonomically accepted species in the genus Schizocladia (Guiry and Guiry 2020), and there are four rbcL sequences in GenBank representing the species. The rbcL (Tab. 5: 1006 bp) and RuBisCO spacer (Tab. 5: 82 bp) produced values of 99.8% and 100% identity respectively to the sequence with GenBank accession number MN996275 (Rizouli et al. 2020). This species identification was determined with a high level of confidence.
The genus Hecatonema currently includes 11 species (Guiry and Guiry 2020) and there are 42 COI and three rbcL sequences in GenBank representing this genus. The COI sequence (Tab. 5: 633 bp) produced a high identity (100%) with the sequence having GenBank accession number LM995391 (Peters et al. 2015, as Hecatonema maculans) and this was determined with a high level of confidence. In addition, the rbcL and RuBisCO spacer further confirmed this conclusion since the closest hit in GenBank was to an unpublished sequence of Hecatonema sp. (Accession no. AF207802).
Currently, there are 10 species that are accepted taxonomically in the genus Colpomenia (Guiry and Guiry 2020) and these are represented by 41 COI and 116 rbcL sequences in GenBank. The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 189 bp) provided 100% and 97.4% identity, respectively, to the published C. sinuosa sequence with GenBank accession number AF385839 (Cho et al. 2001), and the species identification was determined with a high level of confidence. The COI sequence (Tab. 5: 538 bp) provided the closest hit (97.3% identity) to a sequence of C. sinuosa with accession number KF281125 (McDevit and Saunders 2017). The COI marker did not provide species identity.
Striaria attenuata is the only taxonomically accepted species in the genus (Guiry and Guiry 2020) and there is only one rbcL sequence in GenBank representing it. The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 181 bp) provided 100% and 98.3% identity respectively to the published S. attenuata sequence having GenBank accession number AF055415 (Siemer et al. 1998).
There are 10 species currently accepted taxonomically in the genus Asperococcus, with six COI and 10 rbcL sequences in GenBank representing this genus. The COI sequence (Tab. 5: 625 bp) resulted in an identity of 99.8% to the A. bullosus sequence having GenBank accession no MN1184505 (Bringloe et al. 2019). In addition, the rbcL provided supporting information with a 99.6% level identity to the published A. bullosus sequence having GenBank accession number LC016509 (Kawai et al. 2016).
AlgaeBase currently lists 39 taxonomically accepted species for the genus Sphacelaria (Guiry and Guiry 2020), but only nine COI sequences are available in GenBank to represent these. The COI sequence (Tab. 5: 608 bp) gave a 99.3% identity to the Sphacelaria sp. sequence having GenBank accession number LM994971 (Peters et al. 2015). This genus-level identification was determined with high confidence.
It is evident that COI and rbcL together with the RuBisCO spacer reference sequences are not always available in GenBank, and when found, they are not always defined up to species-level.
Another result of this study is the updated marine algal species list for Malta, given in the on-line Suppl. Tab. 1. The species list now consists of 69 Phaeophyceae, 1 member of the Schizocladiophyceae, 194 Florideophyceae, 4 Bangiophyceae, 3 Compsopogonophyceae, 1 Palmophyllophyceae, 3 Stylonematophyceae and 63 Ulvophyceae. There are a total of 338 species, also including the new records discovered in this work.
Discussion
Through the combination of the GE method, isolation of strains and DNA barcoding targeting the cytoplasmic markers COI and rbcL plus the RuBisCO spacer, the heterokont benthic multicellular algae Schizocladia ischiensis (Schizocladiophyceae), Hecatonema terminale and Striaria attenuata (Phaeophyceae) are being reported for the first time from the waters around the Maltese islands in the central Mediterranean. For three additional brown algae, Colpomenia sinuosa, Asperococcus bullosus and Sphacelaria sp., DNA sequences confirmed previous morphology-based records in Malta (Cormaci et al. 1997,Borg et al. 1998). All the species and genera presented in this study are identified only to the level at which there is high-level confidence.
Schizocladia ischiensis (Fig. 1) was germinated from a substratum sample collected at Marsascala at a depth of 22 m. The thallus was made up of branched filaments of 3–7 μm diameter, each containing one or two brown parietal plastids. The zoospores, which have a teardrop-shape and an eyespot (Kawai et al. 2003), were not examined in this study. Molecular phylogenies indicate a close relationship to Phaeophyceae; however, Schizocladia belongs to a different class since it lacks cellulose and plasmodesmata in the cell wall and the presence of a flagellar transitional helix (Kawai et al. 2003). The class Schizocladiophyceae and the species S. ischiensis were originally described from a single strain (KU-333) isolated from substratum collected off the island of Ischia near Naples in Italy; the diagnosis was based on photosynthetic pigment analysis, morphology, and molecular phylogenies (Kawai et al. 2003). The rbcL and RuBisCO spacer sequences obtained for the Maltese isolate are almost identical to those from a S. ischiensis strain from Naples (Tab. 5: rbcL 99.8% identity and RuBisCO spacer 100% identity with MN996275,Rizouli et al. 2020), but slightly different from strain RH15-53 (rbcL 99.4% identity and RuBisCO spacer 97.6% identity to LC521905), a recent record off the Greek island of Rhodes (Rizouli et al. 2020).
A germling of H. terminale (Fig. 2) emerged from a stone fragment collected from Cirkewwa, Malta, at the outfall of a desalination plant. Species of the genus Hecatonema are confluent microscopic tufts that could also be solitary (Parente et al. 2010). They consist of a monostromatic basal layer, which in some places could be distromatic, from which unbranched or sparsely branched filaments arise (Fletcher 1987). Hecatonema terminale is abundant in Brittany and has been reported in the Mediterranean from Ischia and Naples in Italy, Korinthiakos Gulf, Korinthos in Greece (Peters et al. 2015, as Hecatonema maculans), as well as from Sicily (Giaccone et al. 1985). The family Hecatonemataceae (tribu Hecatonematees in Loiseaux, 1967) are currently placed within the Chordariaceae (Peters and Ramıirez 2001). COI sequences suggest that this clade might form a separate family (Peters et al. 2015), but this is yet to be confirmed by multi-gene phylogenies. The comparison with COI sequences deposited in GenBank shows that the sequence obtained for the Maltese isolate is identical to that of strain GR11-52B from Greece (Tab. 5: 100% identity to LM995391,Peters et al. 2015).
Colpomenia sinuosa (Fig. 3) was isolated from a pebble collected at a depth of 1.5 m at the outfall of the same desalination plant in Cirkewwa. Preliminary morphological identification indicated the strain belonged to C. sinuosa, the type species of this genus, which was then confirmed through sequencing of the rbcL and RuBisCO markers, which gave a high percentage identity to a strain from Jeju, Korea (Tab. 5: rbcL 100% identity and RuBisCO spacer 97.4% identity to AF385839,Cho et al. 2001). The COI gene provided a 97.3% identity to C. sinuosa (Tab. 5: KF281125,McDevit and Saunders, 2017). There are only eight COI sequences for C. sinuosa on GenBank and they all originate from Korea (two sequences) or Australia (six sequences). The comparison with COI sequences deposited in GenBank shows that the Maltese isolate could be a cryptic species. Cryptic speciation in C. sinuosa has been studied through the use of the rbcL and cox3 gene, which have shown that there are three main genetic groups (Lee et al. 2013). The rbcL of the Maltese isolate provided the highest identity (99.6, 100 and 100% respectively) to AY398468, AB022234, AB578988, i.e. C. sinuosa Group 1 inLee et al. (2013). Group 1 is the most diverse group and includes five subgroups from both temperate and tropical waters. However, it is probable that there are no COI sequences in GenBank for this group. Further molecular investigations are thus required for C. sinuosa, especially to sequence the COI gene from specimen growing in different areas including the type locality in Cadiz, Spain (Guiry and Guiry, 2020), as well as from different areas in the Mediterranean Sea.
Colpomenia sinuosa occurs intertidally and subtidally (Cho et al. 2009) and is widespread in temperate and warm waters, penetrating boreal waters (Guiry and Guiry, 2020). Colpomenia sinuosa and C. peregrina Sauvageau, both have a spherical and saccate appearance and both occur around Malta. The main difference between the two is that C. sinuosa has plurilocular sporangial punctate sori with a cuticle and four to six layers of medullary cells, as opposed to extensive sori without a cuticle and a thinner thallus wall of three to four layers of colourless medullary cells in C. peregrina (Toste et al. 2003).
For this study, S. attenuata and A. bullosus specimens were collected in Gozo from the Blue Hole at Dwejra. Previously, the presence of S. attenuata had been recorded in different Mediterranean locations including Sicily (Giaccone et al. 1985) and Karpasia in Cyprus (Tsiamis et al. 2014), but it had never been identified from the Maltese islands. On the other hand, A. bullosus had been morphologically identified in the north-eastern coast of Malta (Borg et al. 1998). The analysis of the new biomarkers of S. attenuata obtained in this study resulted in a high percentage identity to strain Sat 49 from Chile (Tab. 5: rbcL 100% identity and RuBisCO spacer 98.3% identity to AF055415,Siemer et al. 1998). The sequences obtained for A. bullosus gave a high percentage identity to strain KU-570 from Japan and strain GWS040819 from Norway (Tab. 5: rbcL 99.6% identity to LC016509,Kawai et al. 2016 and COI 99.8% identity to MN184505,Bringloe et al. 2019).
The Sphacelaria sp. isolate collected from an algal tuft on Padina sp. in St Paul’s Bay, had a high percentage identity to Strain GR11-34 (Tab. 5: COI 99.3% identity to LM994971,Peters et al. 2015) collected from Kavouri (Greece). In this case, the species identity is not obvious, possibly due to the dearth of Sphacelariales COI sequences in the public databases that are attributable to primer mismatches (Peters et al. 2015). In fact, there are only nine COI sequences available in GenBank representing the genus Sphacelaria, which is a highly limited number compared to the 39 species that currently make up this genus (Guiry and Guiry 2020). Thus, further molecular investigations are urgently required for the genus Sphacelaria. Other species of Sphacelaria that have been previously recorded from the Maltese islands on the basis of morphology include S. cirrosa (Roth) C.Agardh, S. fusca (Hudson) S.F.Gray, S. plumula Zanardini, S. rigidula Kützing and S. tribuloides Meneghini (Cormaci et al. 1997).
For the Phaeophyceae, our results confirm that the RuBisCO spacer is more variable than rbcL (Tab. 5) and that this spacer, in combination with other biomarkers, such as cox2-3, could be used to study intraspecific groups in biogeographic studies (Cho et al. 2007).
It is important to note that only C. sinuosa, A. bullosus and Sphacelaria sp. were recorded through the application of morphological surveys and the GE method coupled with DNA barcoding. Thus, without the latter part, our study would have overlooked S. ischiensis, S. attenuata and H. terminale. Thus, our results indicate that algal isolation and culturing in combination with DNA barcoding is a useful unbiased tool to reveal overlooked biodiversity. It also shows that sediment and other substrata, such as pebbles, represent an unexplored environment that harbours countless cryptic microstages of macroalgae with potential for the detection of species. This same method could also be used to detect new introductions of non-indigenous species to the Mediterranean at an early stage. The method also suggests that ‘eradicating’ non-indigenous species by removing the macrothalli is impractical since most algae may exist as microstages in the sediment itself. The GE method certainly has a strong potential to enhance algal biodiversity checklists and is both cost-effective with a low environmental impact in comparison to ship- or ROV-based surveys, such as those targeting deep-water / circalittoral algal communities in the Eastern Mediterranean (Küpper et al. 2019).
Finally, this study provides an updated checklist of marine macroalgal species present in Maltese waters (On-line Suppl. Tab. 1). This was important as it was a challenge to search records of Maltese macroalgae, because these had not been revised since 1997 (Cormaci et al. 1997). Species names were updated to reflect revisions in taxonomy. For instance, previous mentions of Aglaothamnion byssoides and A. tenuissimum have now been recorded as one species in the updated list, A. tenuissimum (Bonnemaison) Feldmann-Mazoyer. Moreover, any references to misidentified algae, such as Asparagopsis armata, which does not occur in Malta (Evans et al. 2015), were removed.
