Introduction
Orchids are of great importance as medicinal, food and ornamental plants in the world. They are under threat of extinction as they are over-collected from nature and their habitats are destroyed (Rasmussen 2002). In addition, orchid tubers are collected too much for salep production and medical purposes in Greece, Iran and Turkey (Sezik 2002,Ghorbani et al. 2014,Kreziou et al. 2016). Although they produce a large number of seeds it is not easy to propagate them in the natural environment by seed germination (Rasmussen 2002). However, seed germination is the most important factor for both medical, commercial and in situ/ex situ conservation and reintroduction. Orchids propagated from seeds are used successfully in reintroduction, especially in orchid protection projects (Paul et al. 2012). Previous research results indicate that more than one fungus joins the mycorrhizal association continuously or seasonally in the roots of orchids (Tondello et al. 2012). Inoculation with appropriate fungus is the most important factor for the orchid to adapt to the natural environment and survive because the population size of orchids and the number of individuals are associated with the presence and abundance of suitable fungi in the soil. The decrease in numbers of particularly rare and threatened species results from the loss of mycorrhizal fungi due to habitat change or destruction (Rasmussen 2002). In this context, understanding the relationship between orchids and fungi is important for the protection of orchids, their reintroduction and production for agricultural purposes. Most orchid mycorrhizal fungi belong to Rhizoctonia-like fungi, a diverse polyphyletic group of pathogens, endophytes, saprophytes and mycorrhizal fungi (Bayman and Otero 2006). This group includes the anamorphic (asexual) genera, Ceratorhiza, Epulorhiza, Moniliopsis, and Rhizoctonia (Moore 1988). The teleomorphs (sexual stages) of these genera are Ceratobasidium, Tulasnella, Sebacina and Thanatephorus, respectively (Bayman and Otero 2006).
Tropical and temperate orchids can also be produced by in vitro asymbiotic methods. However, the procedure requires complete axenic conditions and expensive laboratory equipments. Also, asymbiotic seedlings are difficult for in situ or ex situ adaptation (Aewsakul et al. 2013). Alternatively, successful results have recently been obtained from ex vitro symbiotic seed germination studies. However, there are very few studies in which this method has been applied. Quay et al. (1995) and Aewsakul et al. (2013) germinated some epiphytic orchids symbiotically in ex vitro conditions.
There is not enough research on ex vitro symbiotic seed germination and seedling development of temperate orchids (especially Euroasian tuberous orchids). Due to the glucomannan content of their tubers, orchids have a considerable economic importance as an additive in ice cream, salep and other foods (Sezik 2002). Despite their economic importance, they have not yet been cultured and are under serious threat of extinction due to the collection of thousands of tubers every year. In order to prevent the destruction and extinction of temperate orchids, it is essential to produce them with a fast, easy and inexpensive method. Due to anthropogenic effects and global climate change many orchids will be under a threath of extinction in the near future.
There are five species included in the Serapias genus in Turkey, and Serapias vomeracea (Burm.f.) Briq. is one of the most collected orchid species because they have 1-5 tubers and a high glucomannan content. A large number of studies have been conducted on in vitro asymbiotic and symbiotic germination of the seeds (Ozkoc and Dalcı 1993,Acemi and Ozen 2019). However, temporal fungal diversity in S. vomeracea roots and the effects of these fungi on symbiotic germination and seedling growth in ex vitro conditions have not been investigated.
Hence, the main objectives of this study are: (i) to establish the diversity of fungi participating in mycorrhizal association in the roots of S. vomeracea, (ii) germination of S. vomeracea seeds and seedling formation in the presence of root endophytic fungi in ex vitro conditions, and (iii) to determine whether an ex vitro symbiotic method is suitable for orchid production. It is also hoped that the data obtained from this study will be useful for further reproduction and conservation of this orchid species.
Material and methods
Study site
Serapias vomeracea is distributed in the coastal area of the Black Sea and Aegean regions of Turkey. The research area of this study is Ondokuz Mayıs University campus area. The habitats of the species are the open spaces located next to oak forests at about 50 m a.s.l. The species of the genera Hordeum, Avena and Melilotus are present in these habitats and over 100 S. vomeracea individuals are also represented in the research area. They bloom in May and the seeds maturate in July. In 2015, seasonal avarage temperatures and amount of precipitation were 12.2 °C and 176 mm in spring, 23.9 °C and 85 mm in summer, 16.8 °C and 134 mm in autumn. In 2016, they were: 13.8 °C and 171 mm in spring, 24.8 °C and 69 mm in summer, and 15.1 °C and 133 mm in autumn.
Physical and chemical properties of the soil
For soil analyses, an about 2 kg sample was taken from 0-15 cm depth of 1 m2 area after removing leaves and other debris from the surface of soil in research area where S. vomeracea is commonly distributed. The soil was dried at room temperature in laboratory and used for all analyses.
In the soil saturated with water, a direct pH reading was taken with a glass electrode pH meter (Aciego Pietri and Brookes 2008). Electrical conductivity was determined with an EC – meter in saturation extract (Rhoades 1996), organic matter using the Smith-Weldon method (Nelson and Sommers 1982). Total sand, silt, lime and clay were determined by the densimeter method (Bowman and Hutka 2002). Exchangeable cations (calcium, magnesium, and potassium) were determined with the Mehlich-3 method (Mehlich 1984). Available phosphorus was analysed using the molybdate blue method (Murphy and Ridley 1962).
Fungus isolation
Before root samples were collected, S. vomeracea phenological stages were followed for one year in their habitats (Campus area of Ondokuz Mayis University). It was determined that the leaves formed in February to March and the roots completely dried in July.
The roots for fungi isolation were taken through two years (2015-2016). Every month, complete roots of a plant were collected. Cross-sections were then taken from the roots and examined under a microscope for the presence of fungi. All the roots containing fungal coils were used for fungi isolation, performed according to Clements et al. (1986). The roots were sterilized in 1.5% NaOCl solution for 5 minutes and washed in sterile distilled water. Under aseptic conditions, root pieces (1-2 cm) were placed in petri dishes containing fungi isolation medium (FIM) (Clements et al. 1986) and incubated at 27 °C for 2 days in the dark. Following stereo microscopy examination, any fungal colonies were transferred to FIM and purified. Pure fungus cultures were stored at 4 °C.
Morphological and molecular identification of the fungi
Isolates for preliminary identification were grown in FIM plates and thin agar blocks of 48-h-old cultures were viewed under a microscope for the mycelial and branching characteristics of the isolates. The following distinct morphological characters were observed: mycelia branched at acute to right angles, constrictions at or near the point of branching and septum formation near the branching point. Isolates showing rhizomorph and asexual spore (conidia) structure were defined as non–Rhizoctonia. The isolates were grown in potato dextrose agar (PDA) at 25 ± 2 °C for 7-8 days to determine the color and texture of the colonies. The color of the colony was defined according to the color chart of the Royal Horticultural Society of London. The hypha diameter of the fungi was measured under light microscope. To determine the number of nuclei in the cell, isolates were grown for three days at 25 °C in Petri dishes containing water-agar (WA), stained with Safranine-O solution and nuclei were counted under the microscope (Bandoni 1979).
DNA isolation from fungal mycelia was performed using the CTAB (cetyltrimethyl ammonium bromide) method described by Pascual et al. (2000) with some modifications (e.g., 50 mg of mycelium was crushed in a sterile mortar in 1 mL extraction buffer and incubated for 30 min.) For each isolate, the internal transcribed spacer (ITS) region of the nuclear ribosomal rDNA was amplified by PCR. ITS1 and ITS2 regions, including the ribosomal 5.8S RNA gene, were amplified using the universal primers ITS-1 (5’- TCCGTAGGTGAACCTGCGG-3’) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) (White et al. 1990). PCR amplification reactions were performed in a 50 μl reaction containing 1 μl genomic DNA (1 ng μl-1), 1 μl (2.5 mM) dNTP mix (Sigma), 0.25 μl Taq DNA polymerase (5 U/μl) (Promega, Go-TaqFlexi DNA Polymerase), 1 μl each of primers (25 pmoles), 10 μl 5 × PCR buffer supplied by manufacturer (Promega, Go-Taq Green Buffer) and 3 μl MgCl2 (1.5 mM) (Sigma) and 32.75 μl sterile ddH20. PCR amplification was carried out as follows: an initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 1 min, 49 °C for 2 min, 72 °C for 3 min and a final extension at 72 °C for 7 min (Salazar et al 1999).
PCR products of the rDNA-ITS region were sequenced by Macrogen (Macrogen Inc., Seoul, Republic of Korea) by using ABI 3730 XL DNA sequencer with ITS1 and ITS4 primers. For each PCR product, sequences of both strands were combined to generate a consensus sequence by using BioEdit version 7.2.5 software (Hall 1999). The consensus sequences of the rDNA-ITS region were compared with the sequence data in GenBank (National Center for Biotecnology Information) by using BLASTn tool. We used 97 to 100% sequence identity to delimit fungal species and genera. One sequence for each isolate was deposited in the GenBank database. DNA polymorphism was determined for the ITS gene sequences using DNA Sequence Polymorphism software (DNASP), version 6.0 (Rozas et al. 2017). Haplotype groups were formed according to the nucleotide polymorphism of the sequences. The data set formed for Tulasnella species including the sequence of 15 fungal isolates and the 24 reference sequences obtained from NCBI.
Genetic distances for data sets were calculated using the MEGA 6 software package (Tamura et al. 2013). The tree (Rhizoctonia-like) was constructed using Maximum Likelihood (ML) analysis with 1000 bootstrap replications using MEGA 6.
Collection of the seeds and seed viability test
Capsules produced by natural pollination were collected from the individuals grown in the meadows next to oak forests in 2015. The seeds were removed from the capsules, kept in room conditions for a few days in the laboratory to lose moisture, and then stored at 4 °C. Pre-treatments for viability test and TTC (2,3,5 triphenyl tetrazolium chloride) test were conducted according to Kömpe et al. (2020) and Van Waes and Deberg (1986), respectively. Approximately 100-150 seeds were placed in each pack. The seeds were incubated in moist cocopeat for 7 days so that the seed coat could crack. Thus, TTC would be allowed to enter into the embryo. The seeds were incubated in TTC (1%) solution for 12 hours at 28 °C, followed by 12 h incubation in sterile distilled water. The viability experiments were performed with six repetitions. The seeds with red-pink embryos were evaluated as live. Viability rates (%) = number of stained embryos /total seed number × 100.
Germination of the seeds and development of the seedlings under ex vitro condition
The soil samples were taken from 3-5 cm depth and 30 cm around the adult orchids individuals. A mixture of 2:1 soil: perlite was prepared and sterilized in autoclave at 121°C for 20 min. The sterile soil mixture was filled into pots (20 x 31 x 13 cm) to a depth of 15 cm. The seeds were placed between sheets of water-resistant nylon mesh (45 µm pore size). Approximately 400-500 seeds (10 mg) were placed in each pack. Ten packs of seeds were placed in each pot. Fifteen Rhizoctonia-like (Tulasnella) and four non-Rhizoctonia isolates (Fusarium, Aspergillus, Talaromyces) were used in germination tests. For each fungal isolate, two independent pots containing sterile soil mixture were prepared. Fungi were grown on FIM for 7 days and fungus discs (1-2 mm in diameter) obtained from then were placed in each corner of the pots. Seed packs were placed in control pots not inoculated with fungus. Ex vitro germination and growth experiments were performed with six repetitions. The pots were incubated at 25 ± 2 °C in the climate chamber with a 16/8h light/dark photoperiod and 33 PAR (photosynthetic active radiation). It was irrigated with sterile distilled water once a week. Three months after the seeds were embedded in the pots, 3 seed packs were randomly selected from each pot to calculate germination and seedling growth rates and evaluated according to the scale of Clements et al. (1986).
The extent of seed germination and development was divided into stages: S0, S1, S2, S3 and S4. These stages are represented as follows: S0: No germination (seed); S1: Protocorm; S2: Leaf premordium; S3: The first photosynthetic leaf; S4: Seedling with advanced leaves (and/or rooted).
Germination percentage was calculated as number of seeds in stages 1-4 divided by the total number of seeds (Clements et al. 1986). Germination rates (%) = number of germinated seeds /total seed number X 100.
Microscopic observations of mycorrhizal associations
For showing that mycorrhizal association had been established, transverse sections were taken from experimental protocorms produced ex vitro, from the roots of experimental seedling and from the roots of adult plants in natural habitat, and 0.1% lactophenol (RAL Diagnostic) was dropped and incubated for 10 min at 25 °C. The sections were then washed with distilled water to remove residual staining. Each section was examined under a microscope for presence of fungal coil and photographed.
Statistical analysis
For showing that mycorrhizal association had been established, transverse sections were taken from experimental protocorms produced ex vitro, from the roots of experimental seedling and from the roots of adult plants in natural habitat, and 0.1% lactophenol (RAL Diagnostic) was dropped and incubated for 10 min at 25 °C. The sections were then washed with distilled water to remove residual staining. Each section was examined under a microscope for presence of fungal coil and photographed.
Results
The soil properties were as following: electrical conductivity (EC, dS m-1) 0.896, pH 6.88, organic matters 7%, clay 12.43%, silt 21.79, sand 65.78%, lime: 3.17, Ca + Mg (cmol kg-1) 25.04 + 18.40, P (ppm) 6.21, K (cmol kg-1) 1.76.
The fungi of Serapias vomeracea
In the first year of the experiment, the phenological stages continued from March to July. In the second year they took place between February and June. Fungal isolations were made from March to July in 2015 and from February to June in 2016. From the roots of S. vomeracaea 18 isolates (Svl 1-18) were found in the first year and 16 in the second year (Svl 19-34). Applying the pre-identification procedure, two main isolate groups were determined: binucleate Rhizoctonia-like group with 30 isolates and multinucleate non-Rhizoctonia group with 4 isolates. Rhizoctonia-like (Tulasnella sp.) isolates were found every month when fungal isolation was carried out. Among non-Rhizoctonia isolates, two isolates of Fusarium sp. were isolated in March 2015, one isolate of Aspergillus sp. in June 2015 and one isolate of Talaromyces sp. in February 2016 (Fig. 1). Morphological features of the isolated fungi in both groups (hyphae diameter, number of nuclei, colony color, colony appearance) were determined. Three different colony colors of Rhizoctonia-like isolates were determined after growth on PDA medium at 25 ± 2 °C in the dark for two weeks. The most frequently observed colony color was grayish yellow, while orange-white and yellowish white were observed less frequently. Colony appearance was frequently submerged and powdery. Vegetative hyphae color of all the isolates was transparent. Hyphae diameter varied between 2.5 and 4.4 µm. Vegetative hyphae color of all isolates was transparent. Colony color of the non-Rhizoctonia isolates were determined as red and orange (Svl 10, Svl 11, respectively), white (Svl 13), grayed yellow (Svl 20), while the colony appearance was determined as submerged aerial hyphae and powdery. Vegetative hyphae color of all isolates was transparent. Hyphae diameter varied between 2.5 and 4.4 µm.
The PCR products of the ITS regions of all the fungal isolates were sequenced and aligned. Obtained consensus sequences were uploaded to GenBank and compared with other sequences from that database. Accession numbers for our fungal ITS regions and identity percentages with most closely related sequences from GenBank are given inTab. 1. According to BLASTn results, 2 of the 4 non-Rhizoctonia isolates were found to show 100% identity to Fusarium tritinctum (Svl 10 – Svl 11) (GenBank acession number MK250655, MK250515 respectively), while one isolate was found to show 99% identity to Aspergillus spelaeus (Svl 13) (GenBank accession number MK2505615) and one isolate was found to show 99% identity to Talaromyces pinophilus (Svl 20) (GenBank acession number MK255324). All of the Rhizoctonia-like isolates had identity rates to uncultured Tulasnella (e.g. Svl 1, Svl 3, Svl 4 etc.) of between 97-100% (GenBank acession number MK249887, MK250064, MK250062, respectively) (Tab. 1). A phylogenetic tree was constracted to reveal the phylogenetic relationship between Tulasnella isolates of S. vomeracea and Tulasnella sp. from other orchids (Fig. 2).
Among the ITS sequence data set, 15 haplotypes were detected based on sequence analysis of 30 Tulasnella isolates. ITS sequences exhibited a haplotype diversity of 87%. Haplotype 5 exhibited the highest frequency within the ITS sequences, being generated from 12 sequences. Haplotype 4 and haplotype 7 exhibited low frequencies within the ITS sequences, and were generated respectively from 4 and 2 sequences. Other haplotypes exhibited the lowest frequencies among the ITS sequences, and were generated from only one sequence each. Tulasnella ITS sequences from our study grouped with T. calospora clade. In the phylogenetic tree, Tulasnella isolates (e.g. Svl 3, Svl4, Svl5, Svl9 etc.) isolated from S. vomeracea roots were therefore found to be closely associated with T. calospora. (GenBank accession no: AY373298.1, FJ613176.1, GU166421.1, HQ889722.1 etc.) (Fig. 2).
|
Isolate GenBank designation bp (AN) Close relatives (AN) %ID Reference | |||||
| Svl 3 | 567 | MK250064 | Uncultured Tulasnellaceae (KC243935.1) | 98 | Tĕšitelová et al. 2013 |
| Svl 4 | 547 | MK250062 | Uncultured Tulasnella (JF926504.1) | 100 | Girlanda et al. 2011 |
| Svl 5 | 583 | MK250060 | Uncultured Tulasnellaceae (JX649082.1) | 98 | Bailarote et al. 2012 |
| Svl 9 | 603 | MK250058 | Uncultured Tulasnellaceae (JX649082.1) | 99 | Bailarote et al. 2012 |
| Svl 10 | 548 | MK250655 | Fusarium tricinctum (JX045791.1) | 100 | Unpublished |
| Svl 11 | 609 | MK250515 | Fusarium tricinctum (HQ703409.1) | 100 | Unpublished |
| Svl 12 | 573 | MK256219 | Uncultured Tulasnellaceae (JX649082.1) | 99 | Bailarote et al. 2012 |
| Svl 13 | 609 | MK250156 | Aspergillus spelaeus (MG976863.1) | 97 | Unpublished |
| Svl 14 | 603 | MK250061 | Uncultured Tulasnellaceae (JF926504.1) | 99 | Girlanda et al. 2011 |
| Svl 15 | 608 | MK250075 | Uncultured Tulasnellaceae (JX649082.1) | 99 | Bailarote et al. 2012 |
| Svl 18 | 6 10 | MK250519 | Uncultured Tulasnellaceae (JF926504.1) | 99 | Girlanda et al. 2011 |
| Svl 19 | 510 | MK250524 | Uncultured Tulasnellaceae (JX649082.1) | 99 | Bailarote et al. 2012 |
| Svl 20 | 499 | MK255324 | Talaromyces pinophilus (LT558963.1) | 100 | Guevara-Suarez et al. 2016 |
| Svl 21 | 450 | MK281614 | Uncultured Tulasnellaceae (JF926504.1) | 99 | Girlanda et al. 2011 |
| Svl 22 | 615 | MK250526 | UnculturednTulasnellaceae (JX024734.1) | 99 | Jacquemyn et al. 2012 |
| Svl 29 | 496 | MK250522 | Tulasnella sp (KF537647.1) | 99 | Ding et al. 2014 |
| Svl 30 | 310 | MK250656 | Uncultured Tulasnellaceae (JX649083.1) | 99 | Bailarote et al. 2012 |
| Svl 31 | 406 | MK250520 | Tulasnella sp. (JQ713578.1) | 99 | Unpublished |
| Svl 34 | 603 | MK250530 | Uncultured Tulasnellaceae (JF926504.1) | 100 | Girlanda et al. 2011 |
The seed viability test
The embryos of seeds incubated in cocopeat for 1, 2 and 3 days were not stained. The viability rates of the seeds incubated for 5 days and 7 days were found to be 40.00% ± 9.27 and 90.32% ± 1.30, respectively.
Ex vitro symbiotic germination and symbiotic association with the seeds
Ex vitro germination tests were evaluated for total germination and development stages after three months of incubation. Developmental stages (S1-4) are shown inFig. 3A. Fusarium tricinctum (Svl 10, Svl 11), Aspergillus spelaeus (Svl 13) and Talaromyces (Svl 20) isolates did not promote germination.
There was no germination in the control pots without fungi (Fig. 3B). All the Tulasnella isolates on the phylogenetic tree promoted germination and growth at varying rates (Tab. 2,Fig. 3C-E). According to the counts performed at the end of three months, 98% of seeds germinated in the packages inoculated with the isolate Svl 21 and the seeds inoculated with this isolate developed until to S3. The seeds placed in the pots inoculated with Svl 4, Svl 14 and Svl 34 germinated at the rates of 93.2%, 94% and 90% respectively, and these isolates supported the development of the seedling up to the S4 (13.67%, 10.8%, 9.8%, respectively) (Fig. 3D, E). The percentage of seedlings that reached the S4 of development (13.67%) inoculated with the isolate Svl 4 was found to be statistically significantly high when compared with seedlings reaching the same stage of development inoculated with other fungi.
Thirty seedlings grown in pots (S4- seedlings with advanced leaves (and/or rooted)) were planted in their natural habitats and the first real tubers occurred at 5 months after the seedlings were transferred to the soil. All of the seedlings transferred to soil developed tubers (Fig. 3F).
The presence of symbiotic association was shown in cross-sections from the roots of adult plants, the ex vitro experimental protocorms and the ex vitro experimental seedling roots (Fig. 4A, B, C, respectively).
Discussion
Orchids are in danger of extinction due to severe destructive factors such as destruction of natural habitats, excessive tuber harvesting for medical or commercial purposes, and global climate change (Ghorbani et al. 2014). Symbiotic propagation of orchids with suitable root endophytic fungi is a very advantageous method for reintroduction to the habitats of endangered orchids and for agricultural cultivation (Aewsakul et al. 2013).
During the annual life cycle of the plant, various fungi can join the mycorrhizal association, and a fungus obtained during isolation from roots, especially in the flowering period, may not encourage the germination of the seeds of the same orchid (Girlanda et al. 2011). For this reason, all fungi participating in the mycorrhizal association were obtained by culture-dependent isolation method performed monthly for two consecutive years. It was determined that all our Rhizoctonia-like isolates are closely related to Tulasnella calospora. Girlanda et al. (2011) reported that members of Ceratobasidium as well as Tulasnella joined the mycorrhizal association of S. vomeracea. However, Ceratobasidium was not isolated in our study. All the Tulasnella isolates supported the development at various rates. The differences in development to S4 may be due to the test period being limited to 3 months. Differences in the effects of the fungal isolates on germination and development indicate that isolates related to Tulasnella may be different at species level. Therefore, their precise identification is needed to make using molecular techniques.
It was shown by Fracchia et al. (2014) and Vujanovic et al. (2000) that some Fusarium species promoted germination of tropical orchid seeds. None of the following species, Fusarium tricinctum (Svl 10 and Svl 11), Aspergillus spelaeus (Svl 13) and Talaromyces pinophilus (Svl 20), all isolated in our study, stimulated germination of the seeds.
In recent years, it has been indicated that the members of Pezizales are also members of the mycorrhizal association (Stark et al. 2009). Also, it has been determined that fungi included in the order of Pezizales also join the mycorrhizal association in the roots of Dactylorhiza (Kömpe and Mutlu 2017), Anacamptis and Orchis species (Mutlu and Kömpe 2020). Although non-Rhizoctonia fungi in orchid roots join the mycorrhizal association, it has been reported that they do not establish a symbiotic relationship with seeds (Stark et al. 2009). Our study also indicates that non-Rhizoctonia fungi do not establish a symbiotic relationship with S. vomeraceae seeds.
Orchid tubers are economically important in Turkey, Iran, and Greece. Therefore, large-scale cultures should be set up for their commercialization. Ex vitro symbiotic propagation of orchids has certain advantages over in vitro asymbiotic propagation since the asymbiotic method requires complex laboratory equipment, expensive chemicals and sterile laboratory conditions. In addition, studies on germination and seedling growth in natural conditions (in situ, ex situ) are also not suitable. Structure of the soil, other microorganisms, various insect larvae or nematodes make the efficiency of this method difficult (McCormick et al. 2013). Otherwise, it is stated that ex vitro production is easy, cheap and the most suitable method for mass production (Aewsakul et al. 2013). Soil or a substrate is sterilized to eliminate biotic factors, while superficial, surface sterilization of seeds and other complex laboratory methods and materials are not required.
There are very few studies on ex vitro germination and seedling development of orchid seeds to date and they are about epiphytic orchids (Quay et al. 1995,Aewsakul et al. 2013). Hence, this research is the first study in which the seeds of S. vomeracea, a temperate tuberous orchid, were germinated in ex vitro conditions and the tuber formation in natural conditions was observed. This orchid is one of the most collected orchids because it is one of the orchids with highest glucomanan content (Ozkoç and Dalcı 1993,Acemi and Özen 2019).
According to the results of this study, ex vitro seedlings of S. vomeracea under heavy destruction may establish new populations after being transferred to nature and this may contribute to the rehabilitation of destroyed areas. The most important indicator of the adaptation of tuberous temperate orchids to their natural conditions is the occurence of the first tuber, because it remains in the soil and develops as a new individualin the following year (Sezik 2002). Production of tubers by all seedlings transferred to soil indicates that the reintroduction to natural conditions after ex vitro symbiotic germination is succesful. Thus new populations may be established by applying this method to the other orchids under threat of extinction.
Tetrazolium test showed that viability of the seeds of S. vomeracea (90.32% ± 1.30) was lower than that observed in germination test with Svl21 (98% ± 2). Several studies indicated that the tetrazolium test was not a reliable indicator for orchid seeds (Vujanovic et al. 2000,Kömpe et al. 2020). There may be several reasons for this, which suggests that the viability test is not a good indicator for the germination of orchid seeds. Incubation period may not be sufficient for the breakage of all the seed coats. Water may not reach equally to all seeds in a seed package, or seed coats did not break in a way that the dye can penetrate evenly. For this reason, viability tests must be supported by seed germination tests.
While viability test is not always a reliable indicator of germination potential for orchid seeds, performing a viability test on seeds for which germination potential is not known may be useful to prevent loss of time and materials.
Conclusion
Rhizoctonia-like fungi isolated from S. vomeracea roots are closely related to Tulasnella, therefore it can be said that the dominant fungus of the mycorrhizal association in S. vomeracea is generally Tulasnella. In this research, the life cycle of S. vomeracea from seed to tuberous seedling stage was presented for the first time in ex vitro conditions. With our method, it is possible to produce orchids on a large scale and to prevent orchid destruction and help reintroduction to their natural habitats.
