Skip to the main content

Original scientific paper

https://doi.org/10.37427/botcro-2021-020

DNA barcoding of marine algae from Malta: new records from the central Mediterranean

Angela G. Bartolo orcid id orcid.org/0000-0001-9109-8979 ; University of Aberdeen, School of Biological Sciences, Cruickshank Building, St. Machar Drive, Aberdeen AB24 3UU, Scotland, UK
Gabrielle Zammit ; University of Malta, Laboratory of Applied Phycology, Centre for Molecular Medicine & Biobanking, Fourth floor, Biomedical Sciences Building, Msida, Malta
Hannah Russell ; University of Aberdeen, School of Biological Sciences, Cruickshank Building, St. Machar Drive, Aberdeen AB24 3UU, Scotland, UK
Akira F. Peters ; University of Aberdeen, School of Biological Sciences, Cruickshank Building, St. Machar Drive, Aberdeen AB24 3UU, Scotland, UK
Frithjof C. Küpper ; University of Aberdeen, School of Biological Sciences, Cruickshank Building, St. Machar Drive, Aberdeen AB24 3UU, Scotland, UK


Full text: english pdf 929 Kb

page 176-183

downloads: 853

cite

Download JATS file

Supplements: Bartolo_supplement.pdf


Abstract

The heterokont benthic multicellular algae Schizocladia ischiensis E.C. Henry, K. Okuda et H. Kawai (Schizocladiophyceae), Hecatonema terminale (Kützing) Kylin and Striaria attenuata (Greville) Greville (Phaeophyceae) are reported for the first time from the waters around the Maltese islands in the central Mediterranean. They were identified through algal isolation from incubated natural substrata, coupled with DNA barcoding targeting the biomarkers COI and rbcL plus the RuBisCO spacer. For three additional brown algae, Colpomenia sinuosa (Mertens ex Roth) Derbès et Solier, Asperococcus bullosus J.V.Lamouroux and Sphacelaria sp., DNA sequences confirmed previous morphology-based records from Malta. This paper also provides an updated literature-based species list of the marine macroalgae present in Malta.

Keywords

DNA barcoding; germling emergence; macroalgae; Malta; Mediterranean Sea; Phaeophyceae; Schizocladiophyceae

Hrčak ID:

262324

URI

https://hrcak.srce.hr/262324

Publication date:

1.10.2021.

Visits: 3.744 *




Introduction

During the past 25 years, only seven studies have been published about the diversity of marine macroalgae found around the Maltese islands, and these were entirely based on morphological identification (Borg et al. 1998,Lanfranco et al. 1999,Schembri et al. 2005,Evans et al. 2015,Bonnici et al. 2018,ERA 2020). Of all these studies, the only publication focusing solely on macroalgae was a checklist byCormaci et al. (1997), which reported ‘199 Rhodophyceae, 63 Fucophyceae and 57 Chlorophyceae’, making up a total of 319 macroalgal species in Malta. To date, no DNA studies have been conducted specifically to identify Maltese macroalgae, and indeed, few such studies have been carried out in the Mediterranean area as a whole (Bartolo et al. 2020).

Molecular tools have challenged the idea that marine species have wide geographical ranges. Instead, they have demonstrated that some marine macroalgal ‘species’ actually consist of several geographically restricted cryptic species, i.e. species which are classified as one due to a lack of or only few morphological differences (Payo et al. 2012). Broad distribution ranges of many algae can be attributed to pervasive cryptic diversity (Tronholm et al. 2012). Moreover, molecular assessment of the diversity of macroalgal species has demonstrated that morphological species identification underestimates the diversity in a given location (Payo et al. 2012,Vieira et al. 2017).

For the present study, substrata around the Maltese islands were sampled to reveal macroalgal biodiversity from cryptic life stages, including species with microscopic thalli. We used the germling emergence (GE) method in combination with DNA barcoding of the 5’-end of the mitochondrial cytochrome c oxidase subunit 1 gene (COI) and the plastid-encoded large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) markers to identify algal species. The study of macroalgal microstages and microscopic species in situ is a challenging task, which was overcome by the germination and isolation of microscopic algal stages and microscopic species in vitro. This GE method has shown a potential for increasing the biogeographic and taxonomic knowledge on macroalgae (Peters et al. 2015). In fact, here we present three macroalgal species that were previously unreported from the Maltese islands and confirm the presence of another three algal species.

Materials and methods

Substratum samples, including small pebbles and shell fragments, as well as Posidonia oceanic (Linnaeus) Delile and Padina pavonica (Linnaeus) Thivy fragments, were collected from four sites in the Maltese islands (Tab. 1).

Tab. 1 Provenance of strains including spatial data collected by means of a hand-held Garmin 78s Marine Global Positioning System (GPS) device. All samples were found submerged in seawater.
Isolate numberLocationCoordinatesSite descriptionDepth (m)
MT17-026Saint Paul’s Bay, Malta35°56.976' NBeneath Wignacourt Tower,1
14°24.056' Eon Posidonia oceanica leaf
MT17-059Cirkewwa, Malta35°59.162' NNear desalination plant outfall,1.5
14°20.305' Eon hard substratum
MT17-068Cirkewwa, Malta35°59.162' NNear desalination plant outfall,1.5
14°20.305' Eon large stone
MT17-092Dwejra, Gozo36°03.185' NBlue Hole, on hard substratum18.4
14°11.283' E
MT17-099Dwejra, Gozo36°03.185' NCollapsed rock debris,16.9
14°11.283' Efresh colonisation
MT17-100Marsascala, Malta35°52.036' NClose to wreck,22
14°34.421' Efrom soft substratum

Algal germlings were isolated from the substratum using the GE method (Peters et al. 2015), which involves the incubation of the substratum in a herbivore-free and nutrient-rich environment. The samples were cultured in 90 mm Petri dishes filled with 35 mL of Provasoli-enriched natural autoclaved seawater (Starr and Zeikus 1993,Coelho et al. 2012), incubated at 18 ºC and exposed to natural light. Clonal strains of filamentous algae were isolated after 1-3 months by cutting fragments of emerging algae under the stereomicroscope and transferring them into new dishes. Monoeukaryotic strains (Tab. 1) were obtained by sub-isolating few-celled thallus fragments.

The isolates were studied via light microscopy (Nikon Eclipse Ti-S inverted microscope connected to a Nikon Digital DS-Fi 1 camera). The keys inCormaci et al. (2012) were used for morphological identification of the species.

DNA was extracted from each specimen using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol modified with a CTAB pre-treatment according toGachon et al. (2009). The DNA was quantified using a Nanodrop 2000 spectrophotometer. Partial COI and rbcL genes, as well as the RuBisCO spacer, were amplified using the primer pairs listed inTab. 2.

Tab. 2 List of primers used in this study, including the target biomarker, name and sequence for each.
BiomarkerPrimer namePrimer No.SequenceReference
COIGazF21CCAACCAYAAAGATATWGGTACLane et al. 2007
GazR22GGATGACCAAARAACCAAAALane et al. 2007
DumR13AAAAAYCARAATAAATGTTGASaunders 2005
rbcL and RuBisCO spacerrbcLP2F/ rbcL40DF4GAWCGRACTCGAWTWAAAAGTGKawai et al. 2007
rbcS139R5AGACCCCATAATTCCCAATAPeters and Ramírez 2001
rbcLrbcL1273F6GTGCGACAGCTAACCGTGPeters et al. 2010
rbcS139R7As aboveAs above

PCR amplifications were performed in a total volume of 50 μL, containing approximately 100 ng of DNA, a deoxynucleoside triphosphate mixture (0.2 mM each), supplemented to give a final concentration of 1.8 mM MgCl2, 0.625 U of OneTaq Quick Load 2× Master Mix with Standard Buffer (New England Biolabs, Inc.), 0.5 pmol of each primer and of 21 μL nuclease-free water.

Amplifications were carried out in a GeneAmp thermocycler PCR system 2700 (Applied Biosystems, Foster City, CA, USA) or T3000 thermocycler (Biometra, Jena, Germany) according to the PCR programmes listed inTab. 3. PCR products were verified on 1% (w/v) agarose gel. PCR products were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sequenced via a BigDye Terminator v3.1 Cycle Sequencing Kit on an ABI 3730xl DNA analyser (Applied Biosystems, Foster City, California, USA) at Eurofins Genomics (Germany).

Tab. 3 PCR programme conditions used for each primer pair in this study.
Primer pairsInitialAmplificationFinal extensionReference
CyclesDenaturationAnnealingElongation
1 and 24 min at 94 °C381min at 94 °C30 s at 50 °C1min at 72 °C7 min at 72 °CLane et al. 2007
1 and 31min at 94 °C351min at 94 °C1.5 min at 50 °C1min at 72 °C5 min at 72 °CPeña et al. 2015
4 and 53 min at 95 °C3030 s at 95 °C30 s at 55 °C2 min at 72 °C7 min at 72 °CMuñoz 2016
6 and 73 min at 95 °C3030 s at 95 °C30 s at 55 °C1 min at 72 °C7 min at 72 °CMuñoz 2016

The sequences were manually checked for correctness by inspecting the chromatograms and were compared to published sequences by the Basic Local Alignment Search Tool (BLAST) housed at the United States National Center of Biotechnology Information (Zhang et al. 2000). The nucleotide sequences obtained during this study were deposited in the DDBJ/GenBankTM/EBI Data Bank and Accession numbers are listed inTab. 4.

Tab. 4 List of sequences produced in this study, with the corresponding NCBI accession number.
Isolate numberIdentityrbcL + RuBisCO spacerCOI
MT17-026Sphacelaria sp.-MW580390
MT17-059Colpomenia sinuosaMW659855MW580391
MT17-068Hecatonema terminaleMW659856MW580392
MT17-092Striaria attenuataMW659857-
MT17-099Asperococcus bullosusMW659858MW580393
MT17-100Schizocladia ischiensisMW659859-

The biomarkers obtained were then analysed to arrive at the taxonomic identity of the algae. Taxonomic identities of algae based on molecular studies are highly dependent on the correct identification of DNA sequences in molecular databases, the degree of representation of the species concerned, and the percentage identity between the sequences being compared. The resolving power as species-level cut-off used for COI in the Ectocarpales was 1.8% (Peters et al. 2015). This barcode gap, previously identified empirically byPeters et al. (2015), was confirmed to range from 0.011 to 0.037 K2P pair-wise genetic distance in Ectocarpus (Montecinos et al. 2017), i.e. the equivalent of 1.1% to 3.7%. In fact, for all COI sequences in this study the species-level cut-off applied was more conservative, at 0.6%. In the case of the rbcL gene, a more conservative approach was applied, taking into consideration that the rbcL is less variable (Camacho et al. 2019), with the highest species-level cut-off used being 0.4%. This ensured that all species and genera presented in this study were identified only to the level at which there is high-level confidence.

A literature review was also conducted on Google Scholar to provide an updated macroalgal species list for Malta. The following terms were combined in the search: (“Macroalgae” OR “marine algae” OR “seaweeds” OR “algae” OR “brown algae” OR “Phaeophyceae” OR “Rhodophyta” OR “Chlorophyta” OR “green algae” OR “red algae” OR “alien algae”) AND (“Maltese islands” OR “Malta” OR “Gozo” OR “Comino”). This resulted in seven publications (Cormaci et al. 1997,Borg et al. 1998,Lanfranco et al. 1999,Schembri et al. 2005,Evans et al. 2015,Bonnici et al. 2018,ERA 2020). Further searches were conducted using the ‘distribution’ feature on AlgaeBase (Guiry and Guiry 2020). Moreover, AlgaeBase (Guiry and Guiry 2020) was also used to update the species names in the compiled list to reflect revisions in taxonomy.

Results

In this paper, we report 14 sequences based on surveys in the Maltese islands using COI, rbcL and the RuBisCO spacer. The results include four COI, five rbcL and five RuBisCO spacer barcodes.Tab. 5 provides the results of the BLAST searches including the length of sequence, the percentage identity with the closest hits, as well as the percentage query cover. The BLAST searches resulted in five strains being identified up to species-level and one strain up to genus-level as follows: Schizocladia ischiensis E.C. Henry, K. Okuda et H. Kawai (Schizocladiophyceae), Hecatonema terminale (Kützing) Kylin, Striaria attenuata (Greville) Greville, Colpomenia sinuosa (Mertens ex Roth) Derbès et Solier, Asperococcus bullosus J.V.Lamouroux and Sphacelaria sp.

Tab. 5 Results of BLAST searches including the length of sequence, percentage identity, query cover and details of the closest hit.
Species nameStrainMarkerLength (bp)% Identity% CoverAccessionSpecies name and locality
Colpomenia sinuosaMT17-059rbcL194100100AF385839Colpomenia sinuosa, Korea,Cho et al. 2001
Colpomenia sinuosaMT17- 059spacer18997.4100AF385839Colpomenia sinuosa, Korea,Cho et al. 2001
Colpomenia sp.MT17- 059COI53897.395KF281125C. sinuosa, Australia,McDevit & Saunders, 2017
Sphacelaria sp.MT17- 026COI60899.399LM994971Sphacelaria sp., Greece,Peters et al. 2015
Hecatonema terminaleMT17- 068COI63310098LM995391H. maculans, Greece,Peters et al. 2015
Hecatonema terminaleMT17- 068rbcL140399.9100AF207802Hecatonema sp., unpublished
Hecatonema terminaleMT17- 068spacer20799.599AF207802Hecatonema sp., unpublished
Schizocladia ischiensisMT17- 100rbcL100699.8100MN996275Schizocladia ischiensis, Italy,Rizouli et al. 2020
Schizocladia ischiensisMT17- 100spacer82100100MN996275Schizocladia ischiensis, Italy,Rizouli et al. 2020
Striaria attenuataMT17- 092rbcL194100100AF055415Striaria attenuata, Chile,Siemer et al. 1998
Striaria attenuataMT17- 092spacer18198.3100AF055415Striaria attenuata, Chile,Siemer et al. 1998
Asperococcus bullosusMT17- 099rbcL142799.696LC016509Asperococcus bullosus, Japan,Kawai et al. 2016
Asperococcus bullosusMT17- 099spacer17891.2100AY095321Asperococcus fistulosus, UK,Cho et al. 2003
Asperococcus bullosusMT17- 099COI62599.899MN184505A. bullosus, Norway,Bringloe et al. 2019

Schizocladia ischiensis is the only taxonomically accepted species in the genus Schizocladia (Guiry and Guiry 2020), and there are four rbcL sequences in GenBank representing the species. The rbcL (Tab. 5: 1006 bp) and RuBisCO spacer (Tab. 5: 82 bp) produced values of 99.8% and 100% identity respectively to the sequence with GenBank accession number MN996275 (Rizouli et al. 2020). This species identification was determined with a high level of confidence.

The genus Hecatonema currently includes 11 species (Guiry and Guiry 2020) and there are 42 COI and three rbcL sequences in GenBank representing this genus. The COI sequence (Tab. 5: 633 bp) produced a high identity (100%) with the sequence having GenBank accession number LM995391 (Peters et al. 2015, as Hecatonema maculans) and this was determined with a high level of confidence. In addition, the rbcL and RuBisCO spacer further confirmed this conclusion since the closest hit in GenBank was to an unpublished sequence of Hecatonema sp. (Accession no. AF207802).

Currently, there are 10 species that are accepted taxonomically in the genus Colpomenia (Guiry and Guiry 2020) and these are represented by 41 COI and 116 rbcL sequences in GenBank. The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 189 bp) provided 100% and 97.4% identity, respectively, to the published C. sinuosa sequence with GenBank accession number AF385839 (Cho et al. 2001), and the species identification was determined with a high level of confidence. The COI sequence (Tab. 5: 538 bp) provided the closest hit (97.3% identity) to a sequence of C. sinuosa with accession number KF281125 (McDevit and Saunders 2017). The COI marker did not provide species identity.

Striaria attenuata is the only taxonomically accepted species in the genus (Guiry and Guiry 2020) and there is only one rbcL sequence in GenBank representing it. The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 181 bp) provided 100% and 98.3% identity respectively to the published S. attenuata sequence having GenBank accession number AF055415 (Siemer et al. 1998).

There are 10 species currently accepted taxonomically in the genus Asperococcus, with six COI and 10 rbcL sequences in GenBank representing this genus. The COI sequence (Tab. 5: 625 bp) resulted in an identity of 99.8% to the A. bullosus sequence having GenBank accession no MN1184505 (Bringloe et al. 2019). In addition, the rbcL provided supporting information with a 99.6% level identity to the published A. bullosus sequence having GenBank accession number LC016509 (Kawai et al. 2016).

AlgaeBase currently lists 39 taxonomically accepted species for the genus Sphacelaria (Guiry and Guiry 2020), but only nine COI sequences are available in GenBank to represent these. The COI sequence (Tab. 5: 608 bp) gave a 99.3% identity to the Sphacelaria sp. sequence having GenBank accession number LM994971 (Peters et al. 2015). This genus-level identification was determined with high confidence.

It is evident that COI and rbcL together with the RuBisCO spacer reference sequences are not always available in GenBank, and when found, they are not always defined up to species-level.

Another result of this study is the updated marine algal species list for Malta, given in the on-line Suppl. Tab. 1. The species list now consists of 69 Phaeophyceae, 1 member of the Schizocladiophyceae, 194 Florideophyceae, 4 Bangiophyceae, 3 Compsopogonophyceae, 1 Palmophyllophyceae, 3 Stylonematophyceae and 63 Ulvophyceae. There are a total of 338 species, also including the new records discovered in this work.

Discussion

Through the combination of the GE method, isolation of strains and DNA barcoding targeting the cytoplasmic markers COI and rbcL plus the RuBisCO spacer, the heterokont benthic multicellular algae Schizocladia ischiensis (Schizocladiophyceae), Hecatonema terminale and Striaria attenuata (Phaeophyceae) are being reported for the first time from the waters around the Maltese islands in the central Mediterranean. For three additional brown algae, Colpomenia sinuosa, Asperococcus bullosus and Sphacelaria sp., DNA sequences confirmed previous morphology-based records in Malta (Cormaci et al. 1997,Borg et al. 1998). All the species and genera presented in this study are identified only to the level at which there is high-level confidence.

Schizocladia ischiensis (Fig. 1) was germinated from a substratum sample collected at Marsascala at a depth of 22 m. The thallus was made up of branched filaments of 3–7 μm diameter, each containing one or two brown parietal plastids. The zoospores, which have a teardrop-shape and an eyespot (Kawai et al. 2003), were not examined in this study. Molecular phylogenies indicate a close relationship to Phaeophyceae; however, Schizocladia belongs to a different class since it lacks cellulose and plasmodesmata in the cell wall and the presence of a flagellar transitional helix (Kawai et al. 2003). The class Schizocladiophyceae and the species S. ischiensis were originally described from a single strain (KU-333) isolated from substratum collected off the island of Ischia near Naples in Italy; the diagnosis was based on photosynthetic pigment analysis, morphology, and molecular phylogenies (Kawai et al. 2003). The rbcL and RuBisCO spacer sequences obtained for the Maltese isolate are almost identical to those from a S. ischiensis strain from Naples (Tab. 5: rbcL 99.8% identity and RuBisCO spacer 100% identity with MN996275,Rizouli et al. 2020), but slightly different from strain RH15-53 (rbcL 99.4% identity and RuBisCO spacer 97.6% identity to LC521905), a recent record off the Greek island of Rhodes (Rizouli et al. 2020).

Fig. 1 Light micrograph of Schizocladia ischiensis E.C. Henry, K. Okuda et H. Kawai strain from Malta.
ABC-80-176-f1

A germling of H. terminale (Fig. 2) emerged from a stone fragment collected from Cirkewwa, Malta, at the outfall of a desalination plant. Species of the genus Hecatonema are confluent microscopic tufts that could also be solitary (Parente et al. 2010). They consist of a monostromatic basal layer, which in some places could be distromatic, from which unbranched or sparsely branched filaments arise (Fletcher 1987). Hecatonema terminale is abundant in Brittany and has been reported in the Mediterranean from Ischia and Naples in Italy, Korinthiakos Gulf, Korinthos in Greece (Peters et al. 2015, as Hecatonema maculans), as well as from Sicily (Giaccone et al. 1985). The family Hecatonemataceae (tribu Hecatonematees in Loiseaux, 1967) are currently placed within the Chordariaceae (Peters and Ramıirez 2001). COI sequences suggest that this clade might form a separate family (Peters et al. 2015), but this is yet to be confirmed by multi-gene phylogenies. The comparison with COI sequences deposited in GenBank shows that the sequence obtained for the Maltese isolate is identical to that of strain GR11-52B from Greece (Tab. 5: 100% identity to LM995391,Peters et al. 2015).

Fig. 2 Light micrograph of the Hecatonema terminale (Kützing) Kylin strain from Malta.
ABC-80-176-f2

Colpomenia sinuosa (Fig. 3) was isolated from a pebble collected at a depth of 1.5 m at the outfall of the same desalination plant in Cirkewwa. Preliminary morphological identification indicated the strain belonged to C. sinuosa, the type species of this genus, which was then confirmed through sequencing of the rbcL and RuBisCO markers, which gave a high percentage identity to a strain from Jeju, Korea (Tab. 5: rbcL 100% identity and RuBisCO spacer 97.4% identity to AF385839,Cho et al. 2001). The COI gene provided a 97.3% identity to C. sinuosa (Tab. 5: KF281125,McDevit and Saunders, 2017). There are only eight COI sequences for C. sinuosa on GenBank and they all originate from Korea (two sequences) or Australia (six sequences). The comparison with COI sequences deposited in GenBank shows that the Maltese isolate could be a cryptic species. Cryptic speciation in C. sinuosa has been studied through the use of the rbcL and cox3 gene, which have shown that there are three main genetic groups (Lee et al. 2013). The rbcL of the Maltese isolate provided the highest identity (99.6, 100 and 100% respectively) to AY398468, AB022234, AB578988, i.e. C. sinuosa Group 1 inLee et al. (2013). Group 1 is the most diverse group and includes five subgroups from both temperate and tropical waters. However, it is probable that there are no COI sequences in GenBank for this group. Further molecular investigations are thus required for C. sinuosa, especially to sequence the COI gene from specimen growing in different areas including the type locality in Cadiz, Spain (Guiry and Guiry, 2020), as well as from different areas in the Mediterranean Sea.

Fig. 3 Light micrograph of Colpomenia sinuosa (Mertens ex Roth) Derbès et Solier strain from Malta.
ABC-80-176-f3

Colpomenia sinuosa occurs intertidally and subtidally (Cho et al. 2009) and is widespread in temperate and warm waters, penetrating boreal waters (Guiry and Guiry, 2020). Colpomenia sinuosa and C. peregrina Sauvageau, both have a spherical and saccate appearance and both occur around Malta. The main difference between the two is that C. sinuosa has plurilocular sporangial punctate sori with a cuticle and four to six layers of medullary cells, as opposed to extensive sori without a cuticle and a thinner thallus wall of three to four layers of colourless medullary cells in C. peregrina (Toste et al. 2003).

For this study, S. attenuata and A. bullosus specimens were collected in Gozo from the Blue Hole at Dwejra. Previously, the presence of S. attenuata had been recorded in different Mediterranean locations including Sicily (Giaccone et al. 1985) and Karpasia in Cyprus (Tsiamis et al. 2014), but it had never been identified from the Maltese islands. On the other hand, A. bullosus had been morphologically identified in the north-eastern coast of Malta (Borg et al. 1998). The analysis of the new biomarkers of S. attenuata obtained in this study resulted in a high percentage identity to strain Sat 49 from Chile (Tab. 5: rbcL 100% identity and RuBisCO spacer 98.3% identity to AF055415,Siemer et al. 1998). The sequences obtained for A. bullosus gave a high percentage identity to strain KU-570 from Japan and strain GWS040819 from Norway (Tab. 5: rbcL 99.6% identity to LC016509,Kawai et al. 2016 and COI 99.8% identity to MN184505,Bringloe et al. 2019).

The Sphacelaria sp. isolate collected from an algal tuft on Padina sp. in St Paul’s Bay, had a high percentage identity to Strain GR11-34 (Tab. 5: COI 99.3% identity to LM994971,Peters et al. 2015) collected from Kavouri (Greece). In this case, the species identity is not obvious, possibly due to the dearth of Sphacelariales COI sequences in the public databases that are attributable to primer mismatches (Peters et al. 2015). In fact, there are only nine COI sequences available in GenBank representing the genus Sphacelaria, which is a highly limited number compared to the 39 species that currently make up this genus (Guiry and Guiry 2020). Thus, further molecular investigations are urgently required for the genus Sphacelaria. Other species of Sphacelaria that have been previously recorded from the Maltese islands on the basis of morphology include S. cirrosa (Roth) C.Agardh, S. fusca (Hudson) S.F.Gray, S. plumula Zanardini, S. rigidula Kützing and S. tribuloides Meneghini (Cormaci et al. 1997).

For the Phaeophyceae, our results confirm that the RuBisCO spacer is more variable than rbcL (Tab. 5) and that this spacer, in combination with other biomarkers, such as cox2-3, could be used to study intraspecific groups in biogeographic studies (Cho et al. 2007).

It is important to note that only C. sinuosa, A. bullosus and Sphacelaria sp. were recorded through the application of morphological surveys and the GE method coupled with DNA barcoding. Thus, without the latter part, our study would have overlooked S. ischiensis, S. attenuata and H. terminale. Thus, our results indicate that algal isolation and culturing in combination with DNA barcoding is a useful unbiased tool to reveal overlooked biodiversity. It also shows that sediment and other substrata, such as pebbles, represent an unexplored environment that harbours countless cryptic microstages of macroalgae with potential for the detection of species. This same method could also be used to detect new introductions of non-indigenous species to the Mediterranean at an early stage. The method also suggests that ‘eradicating’ non-indigenous species by removing the macrothalli is impractical since most algae may exist as microstages in the sediment itself. The GE method certainly has a strong potential to enhance algal biodiversity checklists and is both cost-effective with a low environmental impact in comparison to ship- or ROV-based surveys, such as those targeting deep-water / circalittoral algal communities in the Eastern Mediterranean (Küpper et al. 2019).

Finally, this study provides an updated checklist of marine macroalgal species present in Maltese waters (On-line Suppl. Tab. 1). This was important as it was a challenge to search records of Maltese macroalgae, because these had not been revised since 1997 (Cormaci et al. 1997). Species names were updated to reflect revisions in taxonomy. For instance, previous mentions of Aglaothamnion byssoides and A. tenuissimum have now been recorded as one species in the updated list, A. tenuissimum (Bonnemaison) Feldmann-Mazoyer. Moreover, any references to misidentified algae, such as Asparagopsis armata, which does not occur in Malta (Evans et al. 2015), were removed.

Acknowledgements

This research is partially funded by the ENDEAVOUR Scholarship Scheme (Malta)- Group B – National Funds. AGB was supported by the MARS Network for a MARS Travel award, which offered an exciting opportunity to develop this research project at an early stage. Appreciation is due to the Environment & Resources Authority (Malta), the Total Foundation (Paris) and the Marine Alliance for Science and Technology for Scotland pooling initiative (MASTS), the latter funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions. Thanks are due to Eleni Kytinou for diving assistance during sampling. FCK received support from the UK Natural Environment Research Council (program Oceans 2025 – WP 4.5 and grants NE/D521522/1 and NE/J023094/1) and AFP received support from the project IDEALG (France: ANR-10-BTBR-04).

References

 

Bartolo AG, Zammit G, Peters AF, Küpper FC. The current state of DNA barcoding of macroalgae in the Mediterranean Sea: presently lacking but urgently required. Bot Mar. 2020;63:253–72. https://doi.org/10.1515/bot-2019-0041

 

Bonnici L, Borg JA, Evans J, Lanfranco S, Schembri PJ. Of rocks and hard places: Comparing biotic assemblages on concrete jetties versus natural rock along a microtidal Mediterranean shore. J Coast Res. 2018;34:1136–48. https://doi.org/10.2112/JCOASTRES-D-17-00046.1

 

Borg JA, Howege HM, Lanfranco E, Micallef S, Mifsud C, Schembri PJ. The macrobenthic species of the infralittoral to circalittoral transition zone off the northeastern coast of Malta (Central Mediterranean). Xjenza. 1998;3:16–24.

 

Bringloe TT, Sjøtun K, Saunders GW. A DNA barcode survey of marine macroalgae from Bergen (Norway). Mar Biol Res. 2019;15:580–9. https://doi.org/10.1080/17451000.2019.1699659

 

Camacho O, Fernández‐García C, Vieira C, Gurgel CFD, Norris JN, Freshwater DW, et al. The systematics of Lobophora (Dictyotales, Phaeophyceae) in the western Atlantic and eastern Pacific oceans: eight new species. J Phycol. 2019;55:611–24. https://doi.org/10.1111/jpy.12850 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30805921

 

Cho GY, Yoon HS, Choi HG, Kogame K, Boo SM. Phylogeny of the family Scytosiphonaceae (Phaeophyta) from Korea based on sequences of plastid-encoded RuBisCo spacer region. Algae. 2001;16:145–50.

 

Cho TO, Cho GY, Yoon HS, Boo SM, Lee WJ. New records of Myelophycus cavus (Scytosiphonaceae, Phaeophyceae) in Korea and the taxonomic position of the genus on the basis of a plastid DNA phylogeny. Nova Hedwigia. 2003;76:381–98. https://doi.org/10.1127/0029-5035/2003/0076-0381

 

Cho GY, Kogame K, Kawai H, Min Boo S. Genetic diversity of Scytosiphon lomentaria (Scytosiphonaceae, Phaeophyceae) from the Pacific and Europe based on RuBisCO large subunit and spacer, and ITS nrDNA sequences. Phycologia. 2007;46:657–65. https://doi.org/10.2216/06-70.1

 

Cho GY, Choi DW, Kim MS, Boo SM. Sequence repeats enlarge the internal transcribed spacer 1 region of the brown alga Colpomenia sinuosa (Scytosiphonaceae, Phaeophyceae). Phycol Res. 2009;57:242–50. https://doi.org/10.1111/j.1440-1835.2009.00543.x

 

Coelho SM, Scornet D, Rousvoal S, Peters N, Dartevelle L, Peters AF, et al. How to cultivate Ectocarpus. Cold Spring Harb Protoc. 2012;2012:258–61. https://doi.org/10.1101/pdb.prot067934 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22301662

 

Cormaci M, Lanfranco E, Borg JA, Buttigieg S, Furnari G, Micallef SA, et al. Contribution to the knowledge of benthic marine algae on rocky substrata of the Maltese Islands (Mediterranean Sea). Bot Mar. 1997;40:203–16. https://doi.org/10.1515/botm.1997.40.1-6.203

 

Cormaci, M., Furnari, G., Catra, M., Alongi, G., Giaccone, G., 2012: Flora marina bentonica del Mediterraneo: Phaeophyceae. Bollettino dell’Accademia Gioenia di Scienze Naturali di Catania 45(375), 1–508.

 

Evans J, Barbara J, Schembri PJ. Updated review of marine alien species and other ‘newcomers’ recorded from the Maltese Islands (Central Mediterranean). Mediterr Mar Sci. 2015;16:225–44. https://doi.org/10.12681/mms.1064

 

ERA. 2020: Update on Articles 8, 9, and 10 of the Marine Strategy Framework Directive (2008/56/EC) in Malta’s Marine Waters. Retrieved on 22 May 2020 fromhttps://era.org.mt/en/Documents/MSFD_Art.17_Update_Malta_FINAL.pdf

 

Fletcher RL. 1987: Seaweeds of the British Isles. Vol. 3. Fucophyceae (Phaeophyceae). Part 1. British Museum (Natural History), London.

 

Gachon CM, Strittmatter M, Müller DG, Kleinteich J, Küpper FC. Detection of differential host susceptibility to the marine oomycete pathogen Eurychasma dicksonii by real-time PCR: not all algae are equal. Appl Environ Microbiol. 2009;75:322–8. https://doi.org/10.1128/AEM.01885-08 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19011072

 

Giaccone G, Colonna P, Graziano C. Revisione della flora marina di Sicilia e isole minori. Bolletino Accademia Gioenia Scienze Naturali Catania. 1985;18:537–781.

 

Guiry MD, Guiry GM. 2020: AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. Retrieved on 12 April 2020 fromhttps://www.algaebase.org

 

Kawai H, Maeba S, Sasaki H, Okuda K, Henry EC. Schizocladia ischiensis: a new filamentous marine chromophyte belonging to a new class, Schizocladiophyceae. Protist. 2003;154:211–28. https://doi.org/10.1078/143446103322166518 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/13677449

 

Kawai H, Hanyuda T, Draisma SG, Müller DG. Molecular phylogeny of Discosporangium mesarthrocarpum (Phaeophyceae) with a reinstatement of the order Discosporangiales 1. J Phycol. 2007;43:186–94. https://doi.org/10.1111/j.1529-8817.2006.00308.x

 

Kawai H, Hanyuda T, Kim SH, Ichikawa Y, Uwai S, Peters AF. Cladosiphon takenoensis sp. nov. (Ectocarpales sl., Phaeophyceae) from Japan. Phycol Res. 2016;64:212–8. https://doi.org/10.1111/pre.12140

 

Küpper FC, Tsiamis K, Johansson NR, Peters AF, Salomidi M, Manousakis L, et al. New records of the rare deep-water alga Sebdenia monnardiana (Rhodophyta) and the alien Dictyota cyanoloma (Phaeophyta) and the unresolved case of deep-water kelp in the Ionian and Aegean Seas (Greece). Bot Mar. 2019;62:577–86. https://doi.org/10.1515/bot-2019-0033

 

Lane CE, Lindstrom SC, Saunders GW. A molecular assessment of northeast Pacific Alaria species (Laminariales, Phaeophyceae) with reference to the utility of DNA barcoding. Mol Phylogenet Evol. 2007;44:634–48. https://doi.org/10.1016/j.ympev.2007.03.016 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17544704

 

Lanfranco E, Rizzo M, Hall-Spencer J, Borg JA, Schembri PJ. Maerl-forming coralline algae and associated phytobenthos from the Maltese Islands. The Central Mediterranean Naturalist. 1999;3:1–6.

 

Lee KM, Boo SM, Kain JM, Sherwood AR. Cryptic diversity and biogeography of the widespread brown alga Colpomenia sinuosa (Ectocarpales, Phaeophyceae). Bot Mar. 2013;56:15–25. https://doi.org/10.1515/bot-2012-0211

 

McDevit D, Saunders GW. A molecular investigation of Canadian Scytosiphonaceae (Phaeophyceae) including descriptions of Planosiphon gen. nov. and Scytosiphon promiscuous sp. nov. Botany. 2017;95:653–71. https://doi.org/10.1139/cjb-2017-0042

 

Montecinos AE, Couceiro L, Peters AF, Desrut A, Valero M, Guillemin ML. Species delimitation and phylogeographic analyses in the Ectocarpus subgroup siliculosi (Ectocarpales, Phaeophyceae). J Phycol. 2017;53:17–31. https://doi.org/10.1111/jpy.12452 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/27454456

 

Muñoz LA. 2016: Molecular approach to the seaweed biodiversity of Easter Island. MSc Thesis. University of Aberdeen, UK.

 

Parente MI, Fletcher RL, Neto A, Tittley I, Sousa AF, Draisma S, et al. Life history and morphological studies of Punctaria tenuissima (Chordariaceae, Phaeophyceae), a new record for the Azores. Bot Mar. 2010;53:223–31. https://doi.org/10.1515/BOT.2010.030

 

Payo DA, Leliaert F, Verbruggen H, D’hondt S, Calumpong HP, De Clerck O. Extensive cryptic species diversity and fine-scale endemism in the marine red alga Portieria in the Philippines. Proc Biol Sci. 2012;280:20122660. https://doi.org/10.1098/rspb.2012.2660 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23269854

 

Peña V, De Clerck O, Afonso-Carrillo J, Ballesteros E, Bárbara I, Barreiro R, et al. An integrative systematic approach to species diversity and distribution in the genus Mesophyllum (Corallinales, Rhodophyta) in Atlantic and Mediterranean Europe. Eur J Phycol. 2015;50:20–36. https://doi.org/10.1080/09670262.2014.981294

 

Peters AF, Ramírez ME. Molecular phylogeny of small brown algae, with special reference to the systematic position of Caepidium antarcticum (Adenocystaceae, Ectocarpales). Cryptogam, Algol. 2001;22:187–200. https://doi.org/10.1016/S0181-1568(01)01062-5

 

Peters AF, Van Wijk SJ, Cho GY, Scornet D, Hanyuda T, Kawai H, et al. Reinstatement of Ectocarpus crouaniorum Thuret in Le Jolis as a third common species of Ectocarpus (Ectocarpales, Phaeophyceae) in Western Europe, and its phenology at Roscoff, Brittany. Phycol Res. 2010;58:157–70. https://doi.org/10.1111/j.1440-1835.2010.00574.x

 

Peters AF, Couceiro L, Tsiamis K, Küpper FC, Valero M. Barcoding of cryptic stages of marine brown algae isolated from incubated substratum reveals high diversity in Acinetosporaceae (Ectocarpales, Phaeophyceae) 1. Cryptogam, Algol. 2015;36:3–30. https://doi.org/10.7872/crya.v36.iss1.2015.3

 

Rizouli A, Küpper FC, Louizidou P, Mogg A, Azzopardi E, Sayer MDJ, et al. The minute chromophyte alga Schizocladia ischiensis (Schizocladiophyceae, Ochrophyta) raised by germling emergence from substratum collected at 24m depth off Rhodes (Dodecanese, Greece). Diversity (Basel). 2020;12(3):102. https://doi.org/10.3390/d12030102

 

Saunders GW. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos Trans R Soc Lond B Biol Sci. 2005;360:1879–88. https://doi.org/10.1098/rstb.2005.1719 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16214745

 

Schembri PJ, Deidun A, Mallia A, Mercieca L. Rocky shore biotic assemblages of the Maltese Islands (Central Mediterranean): a conservation perspective. J Coast Res. 2005;21:157–66. https://doi.org/10.2112/03-0043R.1

 

Siemer BL, Stam WT, Olsen JL, Pedersen PM. Phylogenetic relationships of the brown algal orders Ectocarpales, Chordariales, Dictyosiphonales, and Tilopteridales (Phaeophyceae) based on RuBisCO large subunit and spacer sequences. J Phycol. 1998;34:1038–48. https://doi.org/10.1046/j.1529-8817.1998.341038.x

 

Starr RC, Zeikus JA. UTEX-The culture collection of algae at the University of Texas at Austin. J Phycol. 1993;29:1–106. https://doi.org/10.1111/j.0022-3646.1993.00001.x

 

Toste MF, Parente MI, Neto AI, Fletcher RL. Life history of Colpomenia sinuosa (Syctosiphonaceae Phaeophyceae) in the Azores. J Phycol. 2003;39:1268–74. https://doi.org/10.1111/j.0022-3646.2003.02-049.x

 

Tronholm A, Leliaert F, Sansón M, Afonso-Carrillo J, Tyberghein L, Verbruggen H, et al. Contrasting geographical distributions as a result of thermal tolerance and long-distance dispersal in two allegedly widespread tropical brown algae. PLoS One. 2012;7(1) https://doi.org/10.1371/journal.pone.0030813 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22292046

 

Tsiamis K, Taşkın E, Orfanidis S, Stavrou P, Argyrou M, Panayotidis P, et al. Checklist of seaweeds of Cyprus (Mediterranean Sea). Bot Mar. 2014;57:153–66. https://doi.org/10.1515/bot-2014-0006

 

Vieira C, Camacho O, Sun Z, Fredericq S, Leliaert F, Payri C, et al. Historical biogeography of the highly diverse brown seaweed Lobophora (Dictyotales, Phaeophyceae). Mol Phylogenet Evol. 2017;110:81–92. https://doi.org/10.1016/j.ympev.2017.03.007 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28279809

 

Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7:203–14. https://doi.org/10.1089/10665270050081478 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/10890397

Floating objects

On-line Suppl. Tab. 1. Malta’s marine macroalgal species list.
Species current accepted name (AlgaeBase)PhylumClassSpecies in publicationSource
Acanthophora nayadiformis (Delile) Papenfuss 1968RhodophytaFlorideophyceaeAcanthophora nayadiformis[3]
Acetabularia acetabulum (Linnaeus) P.C.Silva 1952ChlorophytaUlvophyceaeAcetabularia acetabulum[3]
Acinetospora crinita (Carmichael) Sauvageau 1899OchrophytaPhaeophyceaeAcinetospora crinita[3]
Acrochaetium cf. secundatum (Lyngbye) Nägeli 1858RhodophytaFlorideophyceaeAudouinella cf. virgatula[8]
Acrodiscus vidovichii (Meneghini) Zanardini 1868RhodophytaFlorideophyceaeAcrodiscus vidovichii[3]
Acrosorium ciliolatum (Harvey) Kylin 1924RhodophytaFlorideophyceaeAcrosorium venulosum[3]
Acrothamnion preissii (Sonder) E.M.Wollaston 1968RhodophytaFlorideophyceaeAcrothamnion preissii[5]
Aglaothamnion tenuissimum (Bonnemaison) Feldmann-Mazoyer 1941RhodophytaFlorideophyceaeAglaothamnion byssoides[3]
Alsidium corallinum C.Agardh 1827RhodophytaFlorideophyceaeAlsidium corallinum[3]
Alsidium helminthochorton (Schwendimann) Kützing 1843RhodophytaFlorideophyceaeAlsidium helminthochorton[3]
Amphiroa beauvoisii J.V.Lamouroux 1816RhodophytaFlorideophyceaeAmphiroa beauvoisii[3]
Amphiroa cryptarthrodia Zanardini 1843RhodophytaFlorideophyceaeAmphiroa cyrptarthrodia[3]
Amphiroa rigida J.V.Lamouroux 1816RhodophytaFlorideophyceaeAmphiroa rigida[3]
Anadyomene stellata (Wulfen) C.Agardh 1823ChlorophytaUlvophyceaeAnadyomene stellata[3]
Anotrichium barbatum (C.Agardh) Nägeli 1862RhodophytaFlorideophyceaeAnotrichium barbatum[3]
Anotrichium tenue (C.Agardh) Nägeli 1862RhodophytaFlorideophyceaeAnotrichium tenue[3]
Antithamnion cruciatum (C.Agardh) Nägeli 1847RhodophytaFlorideophyceaeAntithamnion cruciatum[3]
Apoglossum ruscifolium (Turner) J.Agardh 1898RhodophytaFlorideophyceaeApoglossum ruscifolium[3]
Asparagopsis taxiformis (Delile) Trevisan 1845RhodophytaFlorideophyceaeAsparagopsis taxiformis[5]
Asperococcus bullosus J.V.Lamouroux 1813OchrophytaPhaeophyceaeAsperococcus bullosus[2]
Bangia atropurpurea (Mertens ex Roth) C.Agardh 1824RhodophytaBangiophyceaeBangia atropurpurea[3]
Bolbocoleon piliferum Pringsheim 1862ChlorophytaUlvophyceaeBolbocoleon piliferum[8]
Bonnemaisonia asparagoides (Woodward) C.Agardh 1822RhodophytaFlorideophyceaeBonnemaisonia asparagoides[3]
Botryocladia botryoides (Wulfen) Feldmann 1941RhodophytaFlorideophyceaeBotryocladia botryoides[3]
Botryocladia madagascariensis G.Feldmann 1945RhodophytaFlorideophyceaeBotryocladia madagascariensis[3]
Botryocladia microphysa (Hauck) Kylin 1931RhodophytaFlorideophyceaeBotryocladia microphysa[8]
Bryopsis corymbosa J.Agardh 1842ChlorophytaUlvophyceaeBryopsis corymbosa[3]
Bryopsis duplex De Notaris 1844ChlorophytaUlvophyceaeBryopsis duplex[3]
Bryopsis feldmannii Gallardo & G.Furnari 1993ChlorophytaUlvophyceaeBryopsis feldmannii[3]
Bryopsis hypnoides J.V.Lamouroux 1809ChlorophytaUlvophyceaeBryopsis hypnoides[3]
Bryopsis muscosa J.V.Lamouroux 1809ChlorophytaUlvophyceaeBryopsis muscosa[3]
Bryopsis plumosa (Hudson) C.Agardh 1823ChlorophytaUlvophyceaeBryopsis plumosa[3]
Callithamnion corymbosum (Smith) Lyngbye 1819RhodophytaFlorideophyceaeCallithamnion corymbosum[3]
Callithamnion granulatum (Ducluzeau) C.Agardh 1828RhodophytaFlorideophyceaeCallithamnion granulatum[3]
Carpodesmia brachycarpa (J.Agardh) Orellana & Sansón 2019OchrophytaPhaeophyceaeCystoseira brachycarpa[3]
Carradoriella denudata (Dillwyn) A.M.Savoie & G.W.Saunders 2019RhodophytaFlorideophyceaePolysiphonia denudata[3]
Carradoriella elongata (Hudson) A.M.Savoie & G.W.Saunders 2019RhodophytaFlorideophyceaePolysiphonia elongata[3]
Caulacanthus ustulatus (Mertens ex Turner) Kützing 1843RhodophytaFlorideophyceaeCaulacanthus ustulatus[3]
Caulerpa cylindracea Sonder 1845ChlorophytaUlvophyceaeCaulerpa cylindracea[5]
Caulerpa prolifera (Forsskål) J.V.Lamouroux 1809ChlorophytaUlvophyceaeCaulerpa prolifera[3]
Caulerpa taxifolia var. distichophylla (Sonder) Verlaque, Huisman & Procaccini 2013ChlorophytaUlvophyceaeCaulerpa taxifolia v. distichophylla (Sonder)[5]
Centroceras clavulatum (C.Agardh) Montagne 1846RhodophytaFlorideophyceaeCentroceras clavulatum[3]
Ceramium bertholdii Funk 1922RhodophytaFlorideophyceaeCeramium bertholdii[3]
Ceramium ciliatum var. robustum (J.Agardh) Mazoyer 1938RhodophytaFlorideophyceaeCeramium ciliatum[3]
Ceramium circinatum (Kützing) J.Agardh 1851RhodophytaFlorideophyceaeCeramium circinatum[3]
Ceramium codii (H.Richards) Mazoyer 1938RhodophytaFlorideophyceaeCeramium codii[3]
Ceramium comptum Børgesen 1924RhodophytaFlorideophyceaeCeramium comptum[3]
Ceramium derbesii Solier ex Kützing 1847RhodophytaFlorideophyceaeCeramium derbesii[3]
Ceramium diaphanum (Lightfoot) Roth 1806RhodophytaFlorideophyceaeCeramium diaphanum[3]
Ceramium echionotum J.Agardh 1844RhodophytaFlorideophyceaeCeramium echionotum[3]
Ceramium giacconei Cormaci & G.Furnari 1991RhodophytaFlorideophyceaeCeramium giacconei[3]
Ceramium siliquosum (Kützing) Maggs & Hommersand 1993RhodophytaFlorideophyceaeCeramium siliquosum[3]
Ceramium siliquosum var. elegans (Roth) G.Furnari 1999RhodophytaFlorideophyceaeCeramium elegans[3]
Ceramium siliquosum var. lophophorum (Feldman-Mazoyer) Serio 1994RhodophytaFlorideophyceaeCeramium siliquosum v. lophophorum[3]
Ceramium tenerrimum (G.Martens) Okamura 1921RhodophytaFlorideophyceaeCeramium tenerrimum[3]
Ceramium tenuicorne (Kützing) Waern 1952RhodophytaFlorideophyceaeCeramium strictum[3]
Ceramium virgatum Roth 1797RhodophytaFlorideophyceaeCeramium rubrum[3]
Chaetomorpha gracilis Kützing 1845ChlorophytaUlvophyceaeChaetomorpha gracilis[3]
Chaetomorpha aerea (Dillwyn) Kützing 1849ChlorophytaUlvophyceaeChaetomorpha aerea[3]
Chaetomorpha ligustica (Kützing) Kützing 1849ChlorophytaUlvophyceaeChaetomorpha mediterranea[3]
Chaetomorpha linum (O.F.Müller) Kützing 1845ChlorophytaUlvophyceaeChaetomorpha linum[3]
Champia parvula (C.Agardh) Harvey 1853RhodophytaFlorideophyceaeChampia parvula[3]
Chondracanthus acicularis (Roth) Fredericq 1993RhodophytaFlorideophyceaeChondracanthus acicularis[3]
Chondracanthus teedei (Mertens ex Roth) Kützing 1843RhodophytaFlorideophyceaeGigartina teedei[8]
Chondria capillaris (Hudson) M.J.Wynne 1991RhodophytaFlorideophyceaeChondria capillaris[3]
Chondria dasyphylla (Woodward) C.Agardh 1817RhodophytaFlorideophyceaeChondria dasyphylla[3]
Chondria mairei G.Feldmann 1949RhodophytaFlorideophyceaeChondria mairei[3]
Chondria mediterranea (Kützing) M.J.Wynne 2017RhodophytaFlorideophyceaeChondria boryana[3]
Chondria pygmaea Garbary & Vandermeulen 1990RhodophytaFlorideophyceaeChondria pygmaea[3]
Choreonema thuretii (Bornet) F.Schmitz 1889RhodophytaFlorideophyceaeChoreonema thuretii[3]
Chroodactylon ornatum (C.Agardh) Basson 1979RhodophytaStylonematophyceaeChroodactylon ornatum[3]
Chylocladia pelagosae Ercegovic 1956RhodophytaFlorideophyceaeChylocladia pelagosae[3]
Chylocladia verticillata (Lightfoot) Bliding 1928RhodophytaFlorideophyceaeChylocladia verticillata[3]
Cladophora albida (Nees) Kutzing 1843ChlorophytaUlvophyceaeCladophora albida[3]
Cladophora dalmatica Kützing 1843ChlorophytaUlvophyceaeCladophora dalmatica[3]
Cladophora glomerata (Linnaeus) Kützing 1843ChlorophytaUlvophyceaeCladophora glomerata[3]
Cladophora laetevirens (Dillwyn) Kützing 1843ChlorophytaUlvophyceaeCladophora laetevirens[3]
Cladophora lehmanniana (Lindenberg) Kützing 1843ChlorophytaUlvophyceaeCladophora lehmanniana[3]
Cladophora patentiramea (Montagne) Kützing 1849ChlorophytaUlvophyceaeCladophora patentiramea[8]
Cladophora prolifera (Roth) Kützing 1843ChlorophytaUlvophyceaeCladophora prolifera[3]
Cladophora ruchingeri (C.Agardh) Kützing 1845ChlorophytaUlvophyceaeCladophora ruchingeri[3]
Cladophora rupestris (Linnaeus) Kützing 1843ChlorophytaUlvophyceaeCladophora rupestris[3]
Cladophora sericea (Hudson) Kützing 1843ChlorophytaUlvophyceaeCladophora sericea[3]
Cladophora vagabunda (Linnaeus) Hoek 1963ChlorophytaUlvophyceaeCladophora vagabunda[3]
Cladophoropsis membranacea (Hofman Bang ex C.Agardh) Børgesen 1905ChlorophytaUlvophyceaeCladophoropsis membranacea[3]
Cladosiphon cylindricus (Sauvageau) Kylin 1940OchrophytaPhaeophyceaeCladosiphon cylindricus[3]
Cladosiphon mediterraneus Kützing 1843OchrophytaPhaeophyceaeCladosiphon mediterraneus[3]
Cladostephus spongiosus f. verticillatus (Lightfoot) Prud'homme 1972OchrophytaPhaeophyceaeCladostephus spongiosus[3]
Codium bursa (Olivi) C.Agardh 1817ChlorophytaUlvophyceaeCodium bursa[3]
Codium decorticatum (Woodward) M.Howe 1911ChlorophytaUlvophyceaeCodium decorticatum[3]
Codium fragile (Suringar) Hariot 1889ChlorophytaUlvophyceaeCodium fragile[4]
Codium vermilara (Olivi) Delle Chiaje 1829ChlorophytaUlvophyceaeCodium vermilara[3]
Colaconema savianum (Meneghini) R.NielsenRhodophytaFlorideophyceaeAudouinella saviana[8]
Colaconema caespitosum (J.Agardh) Jackelman, Stegenga & J.J.Bolton 1991RhodophytaFlorideophyceaeAudouinella codii[3]
Colpomenia peregrina Sauvageau 1927OchrophytaPhaeophyceaeColpomenia peregrina[5]
Colpomenia sinuosa (Mertens ex Roth) Derbès & Solier 1851OchrophytaPhaeophyceaeColpomenia sinuosa[3]
Contarinia peyssonneliiformis Zanardini 1843RhodophytaFlorideophyceaeContarinia peyssonneliaeformis[3]
Contarinia squamariae (Meneghini) Denizot 1968RhodophytaFlorideophyceaeContarinia squamariae[3]
Corallina officinalis Linnaeus 1758RhodophytaFlorideophyceaeCorallina officinalis[3]
Cottoniella filamentosa var. algeriensis (Schotter) Cormaci & Furnari 1987RhodophytaFlorideophyceaeCottoniella filamentosa[3]
Crouania attenuata (C.Agardh) J.Agardh 1842RhodophytaFlorideophyceaeCrouania attenuata[3]
Cruoria cruoriiformis (P.Crouan & H.Crouan) Denizot 1968RhodophytaFlorideophyceaeCruoria cruoriaeformis[3]
Cryptonemia palmetta (S.G.Gmelin) Woelkering, G.Furnari, Cormaci & J.McNeill 2019RhodophytaFlorideophyceaeCryptonemia lomation[3]
Cryptonemia tuniformis (Bertoloni) Zanardini 1868RhodophytaFlorideophyceaeCryptonemia tuniformis[2]
Cutleria multifida (Turner) Greville 1830OchrophytaPhaeophyceaeCutleria multifida[3]
Cystoseira compressa (Esper) Gerloff & Nizamuddin 1975OchrophytaPhaeophyceaeCystoseira compressa[3]
Cystoseira corniculata (Turner) Zanardini 1841OchrophytaPhaeophyceaeCystoseira corniculata[8]
Cystoseira foeniculacea f. tenuiramosa (Ercegovic) A.Gómez Garreta, M.C.Barceló, M.A.Ribera & J.Rull Lluch 2001OchrophytaPhaeophyceaeCystoseira schiffneri[3]
Cystoseira humilis Schousboe ex Kützing 1860OchrophytaPhaeophyceaeCystoseira humilis[3]
Dasya baillouviana (S.G.Gmelin) Montagne 1841RhodophytaFlorideophyceaeDasya baillouviana[3]
Dasya corymbifera J.Agardh 1841RhodophytaFlorideophyceaeDasya corymbifera[3]
Dasya hutchinsiae Harvey 1833RhodophytaFlorideophyceaeDasya hutchinsiae[3]
Dasya ocellata (Grateloup) Harvey 1833RhodophytaFlorideophyceaeDasya ocellata[3]
Dasya penicillata Zanardini 1865RhodophytaFlorideophyceaeEupogodon penicillatus[3]
Dasya punicea (Zanardini) Meneghini 1841RhodophytaFlorideophyceaeDasya punicea[3]
Dasya rigidula (Kützing) Ardissone 1878RhodophytaFlorideophyceaeDasya rigidula[3]
Dasycladus vermicularis (Scopoli) Krasser 1898ChlorophytaUlvophyceaeDasycladus vermicularis[3]
Derbesia tenuissima (Moris & De Notaris) P.Crouan & H.Crouan 1867ChlorophytaUlvophyceaeDerbesia tenuissima[3]
Dermocorynus dichotomus (J.Agardh) Gargiulo, M.Morabito & Manghisi 2013RhodophytaFlorideophyceaeGrateloupia dichotoma[3]
Dictyopteris polypodioides (A.P.De Candolle) J.V.Lamouroux 1809OchrophytaPhaeophyceaeDictyopteris polypodioides[3]
Dictyota dichotoma (Hudson) J.V.Lamouroux 1809OchrophytaPhaeophyceaeDictyota dichotoma[3]
Dictyota fasciola (Roth) J.V.Lamouroux 1809OchrophytaPhaeophyceaeDictyota fasciola[3]
Dictyota fasciola var. repens (J.Agardh) Ardissone 1883OchrophytaPhaeophyceaeDictyota fasciola v. repens[3]
Dictyota implexa (Desfontaines) J.V.Lamouroux 1809OchrophytaPhaeophyceaeDictyota linearis[3]
Dictyota mediterranea (Schiffner) G.Furnari 1997OchrophytaPhaeophyceaeDictyota mediterranea[3]
Dipterosiphonia rigens (C.Agardh) Falkenberg 1901RhodophytaFlorideophyceaeDipterosiphonia rigens[3]
Discosporangium mesarthrocarpum (Meneghini) Hauck 1885OchrophytaPhaeophyceaeDiscosporangium mesarthrocarpum[3]
Ectocarpus siliculosus (Dillwyn) Lyngbye 1819OchrophytaPhaeophyceaeEctocarpus siliculosus[3]
Ectocarpus siliculosus var. pygmaeus (Areschoug) Gallardo 1992OchrophytaPhaeophyceaeEctocarpus siliculosus v. pygmaeus[3]
Elachista stellaris Areschoug 1842OchrophytaPhaeophyceaeElachista stellaris[3]
Ellisolandia elongata (J.Ellis & Solander) K.R.Hind & G.W.Saunders 2013RhodophytaFlorideophyceaeCorallina elongata[3]
Ericaria amentacea (C.Agardh) Molinari & GuiryOchrophytaPhaeophyceaeCystoseira amentacea[3]
Ericaria barbatula (Kützing) Molinari & GuiryOchrophytaPhaeophyceaeCystoseira barbatula[3]
Ericaria crinita (Duby) Molinari & GuiryOchrophytaPhaeophyceaeCystoseira crinita[3]
Ericaria mediterranea (Sauvageau) Molinari & Guiry 2020OchrophytaPhaeophyceaeCystoseira mediterranea[3]
Ericaria selaginoides (Linnaeus) Molinari & Guiry 2020OchrophytaPhaeophyceaeCystoseira tamariscifolia[3]
Erythrocladia irregularis Rosenvinge 1909RhodophytaCompsopogonophyceaeErythrocladia irregularis[3]
Erythrocystis montagnei (Derbès & Solier) P.C.Silva 1952RhodophytaFlorideophyceaeErythrocystis montagnei[3]
Erythropeltis discigera (Berthold) F.Schmitz 1896RhodophytaCompsopogonophyceaeErythropeltis discigera[3]
Erythrotrichia carnea (Dillwyn) J.Agardh 1883RhodophytaCompsopogonophyceaeErythrotrichia carnea[3]
Eupogodon planus (C.Agardh) Kützing 1845RhodophytaFlorideophyceaeEupogodon planus[3]
Feldmannia lebelii (Areschoug ex P.Crouan & H.Crouan) Hamel 1939OchrophytaPhaeophyceaeFeldmannia caespitula[3]
Feldmannia irregularis (Kützing) Hamel 1939OchrophytaPhaeophyceaeFeldmannia irregularis[3]
Feldmannophycus rayssiae (Feldmann & G.Feldmann) H.Augier & Boudouresque 1971RhodophytaFlorideophyceaeFeldmannophycus rayssiae[3]
Flabellia petiolata (Turra) Nizamuddin 1987ChlorophytaUlvophyceaeFlabellia petiolata[3]
Gastroclonium clavatum (Roth) Ardissone 1883RhodophytaFlorideophyceaeGastroclonium clavatum[3]
Gayliella flaccida (Harvey ex Kützing) T.O.Cho & L.J.McIvor 2008RhodophytaFlorideophyceaeCeramium flaccidum[3]
Gelidium crinale (Hare ex Turner) Gaillon 1828RhodophytaFlorideophyceaeGelidium crinale[3]
Gelidium minusculum (Weber Bosse) R.E.Norris 1992RhodophytaFlorideophyceaeGelidium pusillum v. minusculum[3]
Gelidium pectinatum (Montagne) Montagne 1846RhodophytaFlorideophyceaeGelidium pectinatum[3]
Gelidium pusillum (Stackhouse) Le Jolis 1863RhodophytaFlorideophyceaeGelidium pusillum[3]
Gelidium spathulatum (Kützing) Bornet 1892RhodophytaFlorideophyceaeGelidium spathulatum[3]
Gelidium spinosum (S.G.Gmelin) P.C.Silva 1996RhodophytaFlorideophyceaeGelidium spinosum[3]
Gelidium spinosum var. hystrix (J.Agardh) G.Furnari 1997RhodophytaFlorideophyceaeGelidium spinosum v. hystrix[3]
Gongolaria barbata (Stackhouse) KuntzeOchrophytaPhaeophyceaeCystoseira barbata[3]
Gongolaria elegans (Sauvageau) Molinari & GuiryOchrophytaPhaeophyceaeCystoseira elegans[3]
Gongolaria montagnei (J.Agardh) KuntzeOchrophytaPhaeophyceaeCystoseira spinosa[3]
Gongolaria montagnei var. tenuior (Ercegović) Molinari & GuiryOchrophytaPhaeophyceaeCystoseira spinosa v. tenuior[3]
Gongolaria squarrosa (De Notaris) KuntzeOchrophytaPhaeophyceaeCystoseira squarrosa[3]
Gracilaria dura (C.Agardh) J.Agardh 1842RhodophytaFlorideophyceaeGracilaria dura[8]
Gracilariopsis longissima (S.G.Gmelin) Steentoft, L.M.Irvine & Farnham 1995RhodophytaFlorideophyceaeGracilariopsis longissima[3]
Griffithsia opuntioides J.Agardh 1842RhodophytaFlorideophyceaeGriffithsia opuntioides[3]
Griffithsia schousboei Montagne 1840RhodophytaFlorideophyceaeGriffithsia schousboei[3]
Halimeda tuna (J.Ellis & Solander) J.V.Lamouroux 1816ChlorophytaUlvophyceaeHalimeda tuna[3]
Halopithys incurva (Hudson) Batters 1902RhodophytaFlorideophyceaeHalopithys incurvus[3]
Halopteris filicina (Grateloup) Kützing 1843OchrophytaPhaeophyceaeHalopteris filicina[3]
Halopteris scoparia (Linnaeus) Sauvageau 1904OchrophytaPhaeophyceaeStypocaulon scoparium[3]
Halurus flosculosus (J.Ellis) Maggs & Hommersand 1993RhodophytaFlorideophyceaeGriffithsia arachnoidea[3]
Halydictyon mirabile Zanardini 1843RhodophytaFlorideophyceaeHalodictyon mirabile[3]
Halymenia floresii (Clemente) C.Agardh 1817RhodophytaFlorideophyceaeHalymenia floresia[3]
Hecatonema terminale (Kützing) KylinOchrophytaPhaeophyceae[9]
Herposiphonia secunda (C.Agardh) Ambronn 1880RhodophytaFlorideophyceaeHerposiphonia secunda[3]
Herposiphonia secunda f. tenella (C.Agardh) M.J.Wynne 1985RhodophytaFlorideophyceaeHerposiphonia secunda f. tenella[3]
Heterosiphonia crispella (C.Agardh) M.J.Wynne 1985RhodophytaFlorideophyceaeHeterosiphonia crispella[3]
Hincksia ovata (Kjellman) P.C.Silva 1987OchrophytaPhaeophyceaeHincksia ovata[3]
Huismaniella ramellosa (Kützing) G.H.Boo & S.M.Boo 2016RhodophytaFlorideophyceaeGelidiella ramellosa[3]
Hydroclathrus clathratus (C.Agardh) M.Howe 1920OchrophytaPhaeophyceaeHydroclathrus clathratus[3]
Hydrolithon boreale (Foslie) Y.M.Chamberlain 1994RhodophytaFlorideophyceaeHydrolithon farinosum v. farinosum f. callithamniodes[3]
Hydrolithon cruciatum (Bressan) Y.M.Chamberlain 1994RhodophytaFlorideophyceaeHydrolithon cruciatum[3]
Hydrolithon farinosum (J.V.Lamouroux) Penrose & Y.M.Chamberlain 1993RhodophytaFlorideophyceaeHydrolithon farinosum[3]
Hydrolithon farinosum var. chalicodictyum (W.R.Taylor) Serio 1994RhodophytaFlorideophyceaeHydrolithon farinosum v. chalicodictyum[3]
Hypnea musciformis (Wulfen) J.V.Lamouroux 1813RhodophytaFlorideophyceaeHypnea musciformis[3]
Hypoglossum hypoglossoides (Stackhouse) Collins & Hervey 1917RhodophytaFlorideophyceaeHypoglossum hypoglossoides[3]
Irvinea boergesenii (Feldmann) R.J.Wilkes, L.M.McIvor & Guiry 2006RhodophytaFlorideophyceaeBotryocladia boergesenii[3]
Jania longifurca Zanardini 1844RhodophytaFlorideophyceaeJania longifurca[3]
Jania pedunculata var. adhaerens (J.V.Lamouroux) A.S.Harvey, Woelkerling & Reviers 2020RhodophytaFlorideophyceaeJania adhaerens[3]
Jania rubens (Linnaeus) J.V.Lamouroux 1816RhodophytaFlorideophyceaeJania rubens[3]
Jania rubens var. corniculata (Linnaeus) Yendo 1905RhodophytaFlorideophyceaeJania rubens v. corniculata[1]
Jania virgata (Zanardini) Montagne 1846RhodophytaFlorideophyceaeHaliptilon virgatum[3]
Laurencia minuta subsp. scammaccae G.Furnari & CormaciRhodophytaFlorideophyceaeLaurencia minuta subsp. scammaccae[3]
Laurencia microcladia Kützing 1865RhodophytaFlorideophyceaeLaurencia microcladia[3]
Laurencia obtusa (Hudson) J.V.Lamouroux 1813RhodophytaFlorideophyceaeLaurencia obtusa[3]
Lejolisia mediterranea Bornet 1859RhodophytaFlorideophyceaeLejolisia mediterranea[3]
Lithophyllum byssoides (Lamarck) Foslie 1900RhodophytaFlorideophyceaeLithophyllum byssoides[3]
Lithophyllum incrustans Philippi 1837RhodophytaFlorideophyceaeLithophyllum incrustans[3]
Lithophyllum racemus (Lamarck) Foslie 1901RhodophytaFlorideophyceaeLithophyllum racemus[2]
Lithophyllum stictiforme (Areschoug) Hauck 1877RhodophytaFlorideophyceaeLithophyllum frondosum[3]
Lithothamnion corallioides (P.Crouan & H.Crouan) P.Crouan & H.Crouan 1867RhodophytaFlorideophyceaeLithothamnion corallioides[2]
Lithothamnion minervae Basso 1995RhodophytaFlorideophyceaeLithothamnion minervae[6]
Lobophora variegata (J.V.Lamouroux) Womersley ex E.C.Oliveira 1977OchrophytaPhaeophyceaeLobophora variegata[3]
Lomentaria chylocladiella Funk 1955RhodophytaFlorideophyceaeLomentaria chylocladiella[3]
Lomentaria claviformis Ercegovic 1956RhodophytaFlorideophyceaeLomentaria clavaeformis[3]
Lophocladia lallemandii (Montagne) F.Schmitz 1893RhodophytaFlorideophyceaeLophocladia lallemandii[3]
Lophosiphonia cristata Falkenberg 1901RhodophytaFlorideophyceaeLophosiphonia cristata[3]
Lychaete echinus (Biasoletto) M.J.Wynne 2017ChlorophytaUlvophyceaeCladophora echinus[3]
Lychaete pellucida (Hudson) M.J.Wynne 2017ChlorophytaUlvophyceaeCladophora pellucida[3]
Melanothamnus collabens (C.Agardh) Díaz-Tapia & Maggs 2017RhodophytaFlorideophyceaeStreblocladia collabens[8]
Melobesia membranacea (Esper) J.V.Lamouroux 1812RhodophytaFlorideophyceaeMelobesia membranacea[3]
Meredithia microphylla (J.Agardh) J.Agardh 1892RhodophytaFlorideophyceaeMeredithia microphylla[3]
Mesophyllum alternans (Foslie) Cabioch & M.L.Mendoza 1998RhodophytaFlorideophyceaeMesophyllum alternans[6]
Mesophyllum lichenoides (J.Ellis) Me.Lemoine 1928RhodophytaFlorideophyceaeMesophyllum lichenoides[8]
Microdictyon tenuius J.E.Gray 1866ChlorophytaUlvophyceaeMicrodictyon tenuius[3]
Millerella pannosa (Feldmann) G.H.Boo & L.Le Gall 2016RhodophytaFlorideophyceaeGelidiella pannosa[3]
Monosporus pedicellatus (Smith) Solier 1845RhodophytaFlorideophyceaeMonosporus pedicellatus[3]
Myriactula rivulariae (Suhr ex Areschoug) Feldmann 1937OchrophytaPhaeophyceaeMyriactula rivulariae[3]
Myrionema orbiculare J.Agardh 1848OchrophytaPhaeophyceaeMyrionema orbiculare[3]
Nemacystus flexuosus (C.Agardh) Kylin 1940OchrophytaPhaeophyceaeNemacystus flexuosus[3]
Neogoniolithon brassica-florida (Harvey) Setchell & L.R.Mason 1943RhodophytaFlorideophyceaeNeogoniolithon brassica-florida[3]
Nereia filiformis (J.Agardh) Zanardini 1846OchrophytaPhaeophyceaeNereia filiformis[3]
Neurocaulon foliosum (Meneghini) Zanardini ex Kützing 1849RhodophytaFlorideophyceaeNeurocaulon foliosum[3]
Nitophyllum punctatum (Stackhouse) Greville 1830RhodophytaFlorideophyceaeNitophyllum punctatum[3]
Osmundaria volubilis (Linnaeus) R.E.Norris 1991RhodophytaFlorideophyceaeOsmundaria volubilis[3]
Osmundea pelagosae (Schiffner) K.W.Nam 1994RhodophytaFlorideophyceaeOsmundea pelagosae[8]
Osmundea truncata (Kützing) K.W.Nam & Maggs 1994RhodophytaFlorideophyceaeOsmundea truncata[3]
Padina cf. boergesenii Allender & Kraft 1983OchrophytaPhaeophyceaePadina cf. boergesenii[5]
Padina pavonica (Linnaeus) Thivy 1960OchrophytaPhaeophyceaePadina pavonica[3]
Palisada thuyoides (Kützing) Cassano, Sentíes, Gil-Rodríguez & M.T.Fujii 2009RhodophytaFlorideophyceaeLaurencia paniculata[7]
Palisada perforata (Bory) K.W.Nam 2007RhodophytaFlorideophyceaeLaurencia papillosa[3]
Palmophyllum crassum (Naccari) Rabenhorst 1868ChlorophytaPalmophyllophyceaePalmophyllum crassum[3]
Parvocaulis parvulus (Solms-Laubach) S.Berger, Fettweiss, Gleissberg, Liddle, U.Richter, Sawitzky & Zuccarello 2003ChlorophytaUlvophyceaePolyphysa parvula[3]
Pedobesia simplex (Meneghini ex Kützing) M.J.Wynne & F.Leliaert 2001ChlorophytaUlvophyceaePedobesia lamourouxii[3]
Pedobesia solieri Abélard & Knoepffler 1986ChlorophytaUlvophyceaePedobesia solieri[3]
Petalonia fascia (O.F.Müller) Kuntze 1898OchrophytaPhaeophyceaePetalonia fascia[3]
Peyssonnelia armorica (P.Crouan & H.Crouan) Weber Bosse 1916RhodophytaFlorideophyceaePeyssonnelia armorica[3]
Peyssonnelia bornetii Boudouresque & Denizot 1973RhodophytaFlorideophyceaePeyssonnelia bornetii[3]
Peyssonnelia crispata Boudouresque & Denizot 1975RhodophytaFlorideophyceaePeyssonnelia crispata[3]
Peyssonnelia dubyi P.Crouan & H.Crouan 1844RhodophytaFlorideophyceaePeyssonnelia dubyi[3]
Peyssonnelia harveyana P.Crouan & H.Crouan ex J.Agardh 1851RhodophytaFlorideophyceaePeyssonnelia harveyana[3]
Peyssonnelia heteromorpha (Zanardini) Athanasiadis 2016RhodophytaFlorideophyceaePeyssonnelia polymorpha[3]
Peyssonnelia inamoena Pilger 1911RhodophytaFlorideophyceaePeyssonnelia inamoena[3]
Peyssonnelia rosa-marina Boudouresque & Denizot 1973RhodophytaFlorideophyceaePeyssonnelia rosa-marina[3]
Peyssonnelia rubra (Greville) J.Agardh 1851RhodophytaFlorideophyceaePeyssonnelia rubra[3]
Peyssonnelia squamaria (S.G.Gmelin) Decaisne ex J.Agardh 1842RhodophytaFlorideophyceaePeyssonnelia squamaria[3]
Phaeophila dendroides (P.Crouan & H.Crouan) Batters 1902ChlorophytaUlvophyceaePhaeophila dendroides[3]
Phyllophora crispa (Hudson) P.S.Dixon 1964RhodophytaFlorideophyceaePhyllophora crispa[3]
Phyllophora sicula (Kützing) Guiry & L.M.Irvine 1976RhodophytaFlorideophyceaePhyllophora sicula[3]
Phymatolithon calcareum (Pallas) W.H.Adey & D.L.McKibbin ex Woelkering & L.M.Irvine 1986RhodophytaFlorideophyceaePhymatolithon calcareum[3]
Phymatolithon lenormandii (Areschoug) W.H.Adey 1966RhodophytaFlorideophyceaePhymatolithon lenormandii[3]
Pleonosporium borreri (Smith) Nägeli 1862RhodophytaFlorideophyceaePleonosporium borreri[3]
Plocamium cartilagineum (Linnaeus) P.S.Dixon 1967RhodophytaFlorideophyceaePlocamium cartilagineum[3]
Pneophyllum fragile Kützing 1843RhodophytaFlorideophyceaePneophyllum fragile[3]
Pneophyllum zonale (P.Crouan & H.Crouan) Y.M.Chamberlain 1983RhodophytaFlorideophyceaePneophyllum zonale[3]
Polysiphonia banyulensis Coppejans 1976RhodophytaFlorideophyceaePolysiphonia banyulensis[3]
Polysiphonia biformis Zanardini 1860RhodophytaFlorideophyceaeDasya corallicola[8]
Polysiphonia castelliana De Notaris & L.Dufour 1865RhodophytaFlorideophyceaePolysiphonia castelliana[3]
Polysiphonia dichotoma Kützing 1843RhodophytaFlorideophyceaePolysiphonia dichotoma[3]
Polysiphonia flocculosa (C.Agardh) Endlicher 1843RhodophytaFlorideophyceaePolysiphonia flocculosa[3]
Polysiphonia mottei Lauret 1967RhodophytaFlorideophyceaePolysiphonia mottei[8]
Polysiphonia opaca (C.Agardh) Moris & De Notaris 1839RhodophytaFlorideophyceaePolysiphonia opaca[3]
Polysiphonia sanguinea (C.Agardh) Zanardini 1840RhodophytaFlorideophyceaePolysiphonia sanguinea[3]
Polysiphonia scopulorum Harvey 1855RhodophytaFlorideophyceaePolysiphonia scopulorum[3]
Polysiphonia sertularioides (Grateloup) J.Agardh 1863RhodophytaFlorideophyceaePolysiphonia sertularioides[3]
Polysiphonia spinosa (C.Agardh) J.Agardh 1842RhodophytaFlorideophyceaePolysiphonia spinosa[3]
Porphyra umbilicalis Kützing 1843RhodophytaBangiophyceaePorphyra umbilicalis[3]
Pseudochlorodesmis furcellata (Zanardini) Børgesen 1925ChlorophytaUlvophyceaePseudochlorodesmis furcellata[3]
Pseudochlorodesmis furcellata var. canariensis Børgesen 1925ChlorophytaUlvophyceaePseudochlorodesmis furcellata v. canariensis[3]
Pterocladiella capillacea (S.G.Gmelin) Santelices & Hommersand 1997RhodophytaFlorideophyceaePterocladia capillacea[3]
Pterothamnion crispum (Ducluzeau) Nägeli 1862RhodophytaFlorideophyceaePterothamnion plumula v. bebbii[3]
Pterothamnion plumula (J.Ellis) Nägeli 1855RhodophytaFlorideophyceaePterothamnion plumula v. plumula[3]
Ptilothamnion pluma (Dillwyn) Thuret 1863RhodophytaFlorideophyceaePtilothamnion pluma[3]
Punctaria latifolia Greville 1830OchrophytaPhaeophyceaePunctaria latifolia[3]
Pyropia leucosticta (Thuret) Neefus & J.Brodie 2011RhodophytaBangiophyceaePorphyra leucosticta[3]
Pyropia perforata (J.Agardh) S.C.Lindstrom 2011RhodophytaBangiophyceaePorphyra perforata[3]
Ralfsia verrucosa (Areschoug) Areschoug 1845OchrophytaPhaeophyceaeRalfsia verrucosa[3]
Rhizoclonium riparium (Roth) Harvey 1849ChlorophytaUlvophyceaeRhizoclonium kochianum[8]
Rhizoclonium tortuosum (Dillwyn) Kützing 1845ChlorophytaUlvophyceaeRhizoclonium tortuosum[3]
Rhodophyllis divaricata (Stackhouse) Papenfuss 1950RhodophytaFlorideophyceaeRhodophyllis divaricata[3]
Rhodymenia ardissonei (Kuntze) Feldmann 1937RhodophytaFlorideophyceaeRhodymenia ardissonei[3]
Rhodymenia cf. delicatula P.J.L.Dangeard 1949RhodophytaFlorideophyceaeRhodymenia cf. delicatula[3]
Rhodymenia ligulata ZanardiniRhodophytaFlorideophyceaeRhodymenia ligulata[3]
Rhodymenia pseudopalmata (J.V.Lamouroux) P.C.Silva 1952RhodophytaFlorideophyceaeRhodymenia pseudopalmata[3]
Rodriguezella pinnata (Kützing) F.Schmitz ex Falkenberg 1901RhodophytaFlorideophyceaeRodriguezella pinnata[3]
Rytiphlaea tinctoria (Clemente) C.Agardh 1824RhodophytaFlorideophyceaeRytiphloea tinctoria[3]
Sargassum acinarium (Linnaeus) Setchell 1933OchrophytaPhaeophyceaeSargassum acinarium[3]
Sargassum hornschuchii C.Agardh 1820OchrophytaPhaeophyceaeSargassum hornschuchii[3]
Sargassum natans (Linnaeus) Gaillon 1828OchrophytaPhaeophyceaeSargassum natans[3]
Sargassum vulgare C.Agardh, nom. illeg. 1820OchrophytaPhaeophyceaeSargassum vulgare[3]
Schizocladia ischiensis E.C. Henry, K. Okuda and H. KawaiOchrophytaSchizocladiophyceae[9]
Schottera nicaeensis (J.V.Lamouroux ex Duby) Guiry & Hollenberg 1975RhodophytaFlorideophyceaeSchottera nicaeensis[3]
Scytosiphon lomentaria (Lyngbye) Link, nom. cons. 1833OchrophytaPhaeophyceaeScytosiphon simplicissimus[3]
Spatoglossum solieri (Chauvin ex Montagne) Kützing 1843OchrophytaPhaeophyceaeSpatoglossum solieri[8]
Spermothamnion cf. flabellatum Bornet 1876RhodophytaFlorideophyceaeSpermothamnion cf. flabellatum[3]
Spermothamnion irregulare (J.Agardh) Ardissone 1883RhodophytaFlorideophyceaeSpermothamnion irregulare[3]
Spermothamnion repens var. flagelliferum (De Notaris) Feldmann-Mazoyer 1941RhodophytaFlorideophyceaeSpermothamnion repens[3]
Sphacelaria cirrosa (Roth) C.Agardh 1824OchrophytaPhaeophyceaeSphacelaria cirrosa[3]
Sphacelaria fusca (Hudson) S.F.Gray 1821OchrophytaPhaeophyceaeSphacelaria fusca[3]
Sphacelaria plumula Zanardini 1864OchrophytaPhaeophyceaeSphacelaria plumula[3]
Sphacelaria rigidula Kützing 1843OchrophytaPhaeophyceaeSphacelaria rigidula[3]
Sphacelaria tribuloides Meneghini 1840OchrophytaPhaeophyceaeSphacelaria tribuloides[3]
Sphaerococcus coronopifolius Stackhouse 1797RhodophytaFlorideophyceaeSphaerococcus coronopifolius[3]
Spongonema tomentosum (Hudson) Kützing 1849OchrophytaPhaeophyceaeSpongonema tomentosum[3]
Sporochnus pedunculatus (Hudson) C.Agardh 1817OchrophytaPhaeophyceaeSporochnus pedunculatus[3]
Sporolithon ptychoides Heydrich 1897RhodophytaFlorideophyceaeSporolithon ptychoides[3]
Spyridia filamentosa (Wulfen) Harvey 1833RhodophytaFlorideophyceaeSpyridia filamentosa[3]
Spyridia hypnoides (Bory) Papenfuss 1968RhodophytaFlorideophyceaeSpyridia hypnoides[3]
Stilophora tenella (Esper) P.C.Silva 1996OchrophytaPhaeophyceaeStilophora tenella[3]
Striaria attenuata (Greville) GrevilleOchrophytaPhaeophyceae[9]
Stylonema alsidii (Zanardini) K.M.Drew 1956RhodophytaStylonematophyceaeStylonema alsidii[3]
Stylonema cornu-cervi Reinsch 1875RhodophytaStylonematophyceaeStylonema cornu-cervi[3]
Symphyocladiella parasitica (Hudson) D.Bustamante, B.Y.Won, S.C.Lindstrom & T.O.Cho 2019RhodophytaFlorideophyceaePterosiphonia parasitica[3]
Taonia atomaria (Woodward) J.Agardh 1848OchrophytaPhaeophyceaeTaonia atomaria[3]
Taonia pseudociliata (J.V.Lamouroux) Nizamuddin & Godeh 1993OchrophytaPhaeophyceaeTaonia atomaria f. ciliata[3]
Titanoderma pustulatum (J.V.Lamouroux) Nägeli 1858RhodophytaFlorideophyceaeLithophyllum pustulatum[3]
Tricleocarpa fragilis (Linnaeus) Huisman & R.A.Townsend 1993RhodophytaFlorideophyceaeTricleocarpa fragilis[3]
Ulothrix subflaccida Wille 1901ChlorophytaUlvophyceaeUlothrix subflaccida[8]
Ulva intestinalis f. attenuata (Ahlner) M.J.Wynne 2014ChlorophytaUlvophyceaeEnteromorpha intestinales v. cylindracea[3]
Ulva cf. rigida C.Agardh 1823ChlorophytaUlvophyceaeUlva cf. scandinavica[3]
Ulva clathrata (Roth) C.Agardh 1811ChlorophytaUlvophyceaeEnteromorpha clathrata[3]
Ulva compressa Linnaeus 1753ChlorophytaUlvophyceaeEnteromorpha compressa[3]
Ulva intestinalis Linnaeus 1753ChlorophytaUlvophyceaeEnteromorpha intestinales[3]
Ulva lactuca Linnaeus 1753ChlorophytaUlvophyceaeUlva fasciata[3]
Ulva laetevirens Areschoug 1854ChlorophytaUlvophyceaeUlva laetevirens[3]
Ulva linza Linnaeus 1753ChlorophytaUlvophyceaeEnteromorpha linza[3]
Ulva prolifera O.F.Müller 1778ChlorophytaUlvophyceaeEnteromorpha prolifera[3]
Ulvella lens P.Crouan & H.Crouan 1859ChlorophytaUlvophyceaeUlvella lens[3]
Ulvella leptochaete (Huber) R.Nielsen, C.J.O'Kelly & B.Wysor 2013ChlorophytaUlvophyceaeEntocladia leptochaete[3]
Ulvella scutata (Reinke) R.Nielsen, C.J.O'Kelly & B.Wysor 2013ChlorophytaUlvophyceaePringsheimiella scutata[3]
Ulvella viridis (Reinke) R.Nielsen, C.J.O'Kelly & B.Wysor 2013ChlorophytaUlvophyceaeEntocladia viridis[3]
Valonia macrophysa Kützing 1843ChlorophytaUlvophyceaeValonia macrophysa[3]
Valonia utricularis (Roth) C.Agardh 1823ChlorophytaUlvophyceaeValonia utricularis[3]
Vertebrata fruticulosa (Wulfen) Kuntze 1891RhodophytaFlorideophyceaeBoergeseniella fruticulosa[3]
Vertebrata furcellata (C.Agardh) Kuntze 1891RhodophytaFlorideophyceaePolysiphonia furcellata[3]
Vertebrata subulifera (C.Agardh) Kuntze 1891RhodophytaFlorideophyceaePolysiphonia subulifera[3]
Womersleyella setacea (Hollenberg) R.E.Norris 1992RhodophytaFlorideophyceaeWomersleyella setacea[3]
Wrangelia penicillata (C.Agardh) C.Agardh 1828RhodophytaFlorideophyceaeWrangelia penicillata[3]
Xiphosiphonia pennata (C.Agardh) Savoie & G.W.Saunders 2016RhodophytaFlorideophyceaePterosiphonia pennata[3]
Zanardinia typus (Nardo) P.C.Silva 2000OchrophytaPhaeophyceaeZanardinia prototypus[3]
Zonaria tournefortii (J.V.Lamouroux) Montagne 1846OchrophytaPhaeophyceaeZonaria tournefortii[3]

This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.