Skip to the main content

Original scientific paper

https://doi.org/10.17508/CJFST.2023.15.1.11

Antibiotic sensitivity patterns and molecular detection of Enterotoxin genes in Staphylococcus aureus isolated from frozen muscle foods

Oluwaseyi Akinware ; Department of Microbiology, The Federal University of Technology, PMB 704 Akure, Nigeria
Clement Olusola Ogidi orcid id orcid.org/0000-0002-4154-6750 ; Department of Food Science and Technology, School of Agriculture, Food and Natural Resources, Olusegun Agagu University of Science and Technology, PMB 353, Okitipupa, Nigeria
Bamidele Juliet Akinyele ; Department of Microbiology, The Federal University of Technology, PMB 704 Akure, Nigeria


Full text: english pdf 432 Kb

page 96-104

downloads: 281

cite

Download JATS file


Abstract

Stapylococcus aureus is considered to be the most common pathogen in commonly consumed and improperly stored frozen foods. Hence, this study investigated the antibiotic sensitivity patterns and the occurrence of enterotoxin genes (sea and seb) in S. aureus isolated from frozen poultry meat of chicken, turkey and fish, namely Trachurus trachurus, Scomber scrombus and Merluccious merluccious. A total of 500 samples of raw meat from chicken (n = 130), turkey (n =130), and different fish (n =240) were randomly purchased from various markets and shopping malls in Akure between September 2020 and December 2021. The antibiotic sensitivity of isolated S. aureus was determined by disk diffusion method. S. aureus was analyzed for enterotoxin genes by multiplex polymerase chain reaction (PCR). The highest staphylococcal count (7.70 ×105 CFU/g) was observed in T. trachurus. One hundred and twenty five S. aureus were isolated from meat and fish with the highest occurrence (40.80%) in turkey meat. S. aureus is highly resistant (33.3 to 100%) to the tested antibiotics. The PCR assay, respectively, showed sea and seb coded for staphylococcal enterotoxin A and B. The presence of staphylococcal enterotoxin A and B in frozen muscle foods could be attributed to unhygienic conditions during processing and storage. The occurrence of antibiotic resistant and enterotoxigenic S. aureus in muscle foods could pose a serious threat to people when consumed. Hence, urgent attention is required to avert the incidences of staphylococcal food poisoning after consuming frozen meat and fish.

Keywords

Enterotoxin; polymerase chain reaction; staphylococcal fish; meat

Hrčak ID:

304136

URI

https://hrcak.srce.hr/304136

Publication date:

14.6.2023.

Visits: 1.481 *




Introduction

1.

Frozen meat, fish, poultry and sea foods are important source of proteins in diets and mostly consumed by people of all social strata (Laskowski et al., 2018). Tissues from healthy animals are sterile, but many factors can influence their microbial contamination during slaughtering. Microbial contamination is possible through the water, air, soil, from the workers andthe equipment involved and it often leads to spoilage if not properly handled, processed and preserved (Alegbeleye et al., 2018). The most common method to preserve muscle foods is by chilling and freezing, while super-chilling is also an attractive technique of preserving muscle foods to maintain their freshness, enhancing the shelf-life during storage, transportation and at retail (Banerjee and Maheswarappa, 2019). Freezing preserves muscle foods for extended periods by suppressing the growth and multiplication of microorganisms that could cause food spoilage and foodborne illnesses (Archer, 2004;Zhan et al., 2018). In frozen products, some microorganisms are killed, while others might only be sub-lethally damaged and can recover upon thawing if storage is above -10 °C. Gram negative bacteria are more susceptible to freezing injury than Gram positive bacteria. Hence, it supports the occurrence of Staphylococcus species in frozen meats and fish (Ogofure and Igbinosa, 2021).

S. aureus is a Gram-positive bacteria and facultative anaerobe, which can live as a commensal organism on the skin as well as mucosal membranes. S. aureus recovers and survives sub-lethalinjuries from freezing with cell membrane synthesis-related proteins, oxidative stress resistance-related proteins, and metabolism-related proteins with their virulence factors exhibit distinct expression patterns during resuscitation (Suo et al., 2018). The resuscitation mechanisms adopted by S. aureus together with their multiple antibiotic resistance pose a threat to food safety and are now of public health concern.

The multiple resistance of S. aureus to all β -lactam antibiotics has been linked to the presence of an enzyme; β-lactamase and the mecA gene that encode penicillin-binding protein (PBP2a), which allows the synthesis of the cell wall even at lethal concentrations of β –lactam antibiotics (Atanassova et al., 2017). S. aureus produces a variety of enzymes, toxins (cytotoxins, exotoxins, and exfoliative) with multiple virulence factors encoded by phages, plasmids, and pathogenicity, which has the ability to bind the major histocompatibility complex proteins of their host’s immune system (Tam and Torres, 2019). Staphylococcal food poisoning is an intoxication that occurrs after consuming improperly prepared foods contaminated with S. aureus enterotoxins as a result of unhygienic practices including improper handling of cooked or processed muscles foods, followed by their storage conditions (Argudín et al., 2010). S. aureus is a major cause of food poisoning induced by heat resistant enterotoxin and is one of the leading causes of foodborne illnesses (Varshney et al., 2009;Pinchuk et al., 2010). S. aureus strains produce a large variety of enterotoxins A, B, C, and D that have been frequently detected in poultry meat products (Pepe et al., 2006;Akkaya et al., 2014). Enterotoxin S. aureus is considered to be the most common pathogen causing outbreaks of food poisoning, characterized by symptoms associated with gastroenteritis, including vomiting, nausea, abdominal pain, cramps, diarrhea and causing significant morbidity (Ortega et al., 2010). The contamination of foods with pathogenic microorganisms with reoccurrence of foodborne diseases face significant challenges in modern healthcare services and have substantial negative impacts on economy. Enterotoxins are primarily responsible for foodborne illnesses and morbidity. Hence, frequent screening of staphylococcal enterotoxins (SE) in commonly consumed foods like animal muscle foods, poultry foods, and dairy products is paramount since they are foods of proteins source. This study, therefore, investigated the antibiotics sensitivity patterns and occurrence of enterotoxins S. aureus in selected frozen poultry meat (frozen chicken and turkey) and fish like Scomber scrombus, Trachurus trachurus and Merluccious merluccious vended in Akure metropolis.

Materials and methods

2.

Collection of meat and fish

Samples of frozen meat of chicken (Gallus gallus domesticus) = 130, turkey (Meleagris gallopavo domesticus) = 130, and different fish species, namely, horse mackerel (Trachurus trachurus) = 80, mackerel (Scomber scrombrus) = 80, and hake (Merluccius merluccius) = 80, were randomly purchased at different vendors in Akure. Samples were collected in ice packs and transported to Postgraduate Research Laboratory, Department of Microbiology, The Federal University of Technology, Akure, for microbiological analysis.

Isolation and identification of Staphylococcus aureus

One gram of tissue from each sample was crushed in sterile crucible and serially diluted to ten-fold dilutions, each dilution (104) was plated on mannitol salt agar using pour plate method and incubated at 37 oC for 24 hours. The colonies were counted using colony counter (TT-20, Techmel and Techmel, USA). The colony was sub-cultured to obtain pure isolate. The morphological, Gram’s reaction and biochemical tests like catalase, coagulase, oxidase, methyl red, Voges Proskauer, and sugar fermentation were carried out according to methods ofOlutiola et al. (2000) andCheesbrough (2006). The identity of isolates was determined based on the biochemical reactions usingKrieg et al. (2010).

Antibiotic susceptibility of Staphylococcus

The modified Kirby-Bauer method was used to determine the susceptibility of obtained isolates to some antibiotics as described by The Clinical and Laboratory Standards Institute (CLSI, 2017). The inoculum size in nutrient broth (18 h old culture) was adjusted to 0.5 McFarland turbidity standards to 1.3 × 105 CFU/ml. Thereafter, 0.1 ml of the suspension was transferred to prepared Mueller-Hinton agar and spread with a sterilized glass spreader. The surface of the agar was allowed to dry, antibiotic discs were placed at the equidistance of the plate by sterile forceps and aseptically placed on top of agar plate. The plates were incubated at 37 oC for 18 hours. After incubation, a clear zone of no growth in the immediate vicinity of antibiotic disk was measured and recorded as diameter of zone of inhibition in millimeter (mm), interpreted using CLSI interpretative chat as resistance, intermediate and susceptible (CLSI, 2017).

Genomic DNA extraction and PCR test for staphylococcal enterotoxin genes

S. aureus isolates were further examined for the presence of enterotoxin genes using specific primer in a multiplex PCR assay. DNA of S. aureus was extracted with PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific, USA) according to manufacturer’s instructions. The primers used for the detection of SE genes are listed inTable 1 (Johnson et al., 1991). For polymerase chain reaction amplification, the reaction mixture contained: 2.5 µl 10 X PCR buffer (Invitrogen), 1 µl DNA, 1 µl of primer F (10 pmol), 1 µl of primer R (10 pmol), 0.5 µl dNTP (10 mM, Invitrogen), 1.5 µl MgCl2 (Invitrogen), 0.5 U Taq DNA polymerase (Invitrogen) and final volume was adjusted to 25 µl by adding sterile ultrapure water. DNA amplification was performed in a thermal cycler with initial denaturation at 94 °C for 5 min followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. The amplified PCR products were electrophoresed in a 1.5% agarose gel (Sigma–Aldrich) containing 0.5 mg/ml ethidium bromide, TBE buffer (0.09 M Tris–HCl, 0.09 M boric acid, 2 mM EDTA, pH 8.3) for 30 min at 100 V and visualized under UV trans-illumination.

Table 1 Primers used for the detection of Staphylococcus aureus enterotoxin genes
GenePrimersSequences5’-3’Gene locationSize (bp) of PCR product
seaSEA-Fttggaaacggttaaaacgaa490-509
SEA-Rgaaccttcccatcaaaaaca591-610120
sebSEB-Ftcgcatcaaactgacaaacg634-653
SEB-Rgcaggtactctataagtgcc1091-1110478
Source: (Johnson et al., 1991)

Data analysis

Data was statistically analyzed using SPSS version 20, was separated using Duncan’s New Multiple Range test and significant difference will be value at ƿ ≤ 0.05.

Results and discussion

3.

Table 2 shows total Staphylococcal count (×105 CFU/g) of frozen muscle foods. The staphylococcal count of 0.70 to 7.50 × 105 CFU/g were obtained for meat from chicken, 1.50 to 7.40 × 105 CFU/g, 2.10 to 7.70 ×105 CFU/g, 3.30 to 5.10 × 105 CFU/g and 1.00 to 6.50 ×105 CFU/g were recorded for turkey meat, T. trachurus, S. scombrus and M. merluccious, respectively. Findings ofBodunde et al. (2019) reported Staphylococcus count of 1.70×104 to 6.0×105 CFU/g for different muscle foods like beef (Bos taurus), chicken (Gallus gallus domesticus), turkey (Meleagris gallopavo), pork (Sus scrofa domesticus), chevon (Capra aegagrus hircus), mackerel (Scomber scombrus), horse mackerel (Trachurus trachurus), herrings (Clupea pallasii), blue whiting (Merluccius merluccius), and croaker (Micropogonias undulatus). The higher S. aureus count in meat and fish is a result of improper hygienic practices at the point of handling by slaughter personnel during meat production. Findings ofThwala et al. (2021) reported that a total of 2853 samples containing beef, pork, goat meat, camel meat, sheep/lamb from different African countries were highly contaminated with higher load of S. aureus. Species of Staphylococcus like S. aureus, S. epidermidis, S. xylosus, . sciuri, S. warneri, S. saprophyticus, S. schleiferi and S. auricularis were identified from ready-to-eat fish products (Sergelidis et al. 2014). Humans and animals such as cattle, pigs, chickens, turkey, horses, and sheep can be colonised by S. aureus on their skin and in their nares (Lozano et al., 2016). The frequency of Staphylococci in muscle foods (meat and fish) is revealing how commensal bacteria from human skin and mucosal surfaces contributed to the contamination during different stages of processing; slaughtering, transportation, chopping, storage and persons involved in the marketing (Wu et al., 2018).Table 3 reveals the occurrence of S. aureus in selected frozen muscle foods, meat from chicken, turkey and fish. Frozen meat of turkey has got the highest occurrence of S. aureus 40.80%, followed by meat of chicken with 30.40%, but S. scombrus has got the least occurrence of 2.40%. Findings ofOgofure and Igbinosa (2021) showed that beef had the highest frequency of S. aureus contamination (46.7%), followed by chicken (40.0%) and fish (30.0%).Wu et al. (2018) also reported 35% of S. aureus from 1,850 samples of frozen meat and meat products sold in 39 cities and provincial capitals of China.Savariraj et al. (2021) isolated 66.67% of S. aureus from 120 chicken meat marketed in retail outlets of Chennai, India.

Table 2 Total Staphylococcal count (× 105 CFU/g) of frozen muscle foods vended in Akure
LocationsPoints of collectionChicken
(130)
Turkey
(130)
T. trachurus
(80)
S. scombrus
(80)
M. merluccious
(80)
Kings marketA5.40±0.40 b0.002.20±0.10 d4.20±0.31b6.40±0.29 a
B3.20±0.16 d7.50±0.11 a0.000.000.00
C1.40±0.02 f4.70±0.93 b0.000.000.00
D3.00±0.01 d3.30±0.03 c7.70±0.55 a0.000.00
E0.001.50±0.11 e2.50±0.71 d0.000.00
FUTA South GateA4.30±0.01 c3.10±0.06 c2.20±0.10 d0.002.40±0.02 c
B3.80±0.11 c0.007.70±0.12 a0.001.30±0.00 d
C7.50±0.93 a1.70±0.86 e4.35±0.01 c3.30±0.01 c0.00
D3.30±0.05 d2.40±0.02 d5.40 ±0.32 b0.000.00
Araromi MarketA0.007.40±0.07 a4.40±0.18 c0.001.00±0.00 d
B4.90±0.01 c1.80±0.01 e2.10±0.08 d0.003.20±0.44 b
C5.70±0.36 b3.30±0.11 c0.000.000.00
Isinkan MarketA3.90±0.27 c0.000.000.000.00
B0.70±0.00 i5.50±0.50 b7.50±0.06 a5.10 ±0.02 a0.00
C2.10±0.00 e3.10±0.30 c5.10±0.13 b0.006.50±0.32 a
Shopping Malls0.002.00±0.07 e0.000.000.00
Values are mean of replicates (n=3). Values carrying the same superscript at the column are not significantly different at p < 0.05.
Table 3 Occurrence (%) of Staphylococcus aureus in examined frozen muscle foods
LocationsChicken
(130)
Turkey
(130)
T. trachurus
(80)
S. scombrus
(80)
M. merluccious
(80)
King’s market813516
FUTA South Gate158310
Araromi Market815403
Isinkan Market711814
Shopping malls04000
n385120313
% occurrence30.4040.8016.002.4010.40
n= number of Staphylococcus aureus isolates from meat and fish

Higher prevalence of S. aureus (64%) has been reported from frozen meat and fresh meat from Karbala province in Iraq (Namir et al., 2017). Likewise,Oranusi et al. (2014);Ogidi et al. (2016); andBodunde et al. (2019) reported the prevalence of S. aureus in muscle foods and ready-to- eat foods examined in Nigeria. The prevalence of S. aureus could be attributed to poor hygienic practice of personnel, equipment in slaughterhouses, salesmen and women.Table 4 shows the resistance percentage of S. aureus isolates to rifampin, gentamycin, ampicillin, nitrofurantoin, amoxicillin, oxacillin, fluoroquinolones, streptomycin, vancomycin, erythromycin and trimethoprim/sulfamethoxazole. The resistance percent ranged from 33.3 to 100%. Findings of Parvin et al. (2021) revealed the highest resistance percentage of 73.9% to 100% for S. aureus isolated from frozen chicken meat against cefoxitin, nalidixic acid, ampicillin and oxacillin, colistin, amoxicillin-clavulanic acid and amoxicillin, penicillin-G and cloxacillin, oxytetracycline, and cefixime. Findings ofWang et al. (2017) revealed a total of 1,150 S. aureus isolated from 27,000 retail foods with 97.6% of S. aureus dispalyed resistant to at least one antimicrobial compound like penicillin, oxacillin, cefoxitin, vancomycin, daptomycin, erythromycin, gentamicin, tetracycline, ciprofloxacin, clindamycin, trimethoprim-sulfamethoxazole, chloramphenicol, linezolid and 57.5% of these were multi drug resistant. S. aureus isolated from frozen meat and fish were highly resistant to some of the commercially available antibiotics (Ogofure and Igbinosa, 2021). The researchers reported the antibiotic resistance profile of S. aureus with high resistance to erythromycin (94%), amoxicillin/clavulanic acid (87.5%) and trime- thoprim-sulfamethoxazole (81%). Findings ofWu et al. (2018) revealed that S. aureus isolated from 1,850 retail meat and meat products displayed resistance of 11.0% to 85.4% to ampicillin, penicillin, erythromycin, tetracycline, kanamycin, telithromycin, clindamycin, streptomycin, norfloxacin, gentamicin, fusidic acid, ciprofloxacin, chloramphenicol, amoxycillin/clavulanic acid. S. aureus isolated from Oklahoma retail chicken and turkey meats displayed multiple resistance (5.4 to 94.6%) to ampicillin, tetracycline, penicillin, doxycycline, oxacillin, azithromycin, erythromycin, vancomycin, ciprofloxacin, cefoxitin, gentamicin, kanamycin, clindamycin, rifampin, trimethoprim/sulfamethazole, chloramphenicol with 12 Methicillin-Resistant S. aureus (MRSA) showed 100% resistance to ampicillin, penicillin, cefoxitin with 2% NaCl, oxacillin with 2% NaCl, azithromycin, and erythromycin (Abdalrahman et al., 2015). The use of medically important antibiotics in livestock production is tremendously contributing to multiple antibiotic resistance and pathogenicity of S. aureus (Park and Ronholm, 2021). The ability of various pathogenic bacteria to withstand antibiotic residues in muscle foods contributed to reoccurrence emergency of foodborne diseases, which have become a matter of food security worldwide (Kumar et al., 2020).Figure 1 shows agarose gel electrophoresis of the PCR product of sea gene in selected bacteria isolates (120 bp). Gel image indicates a positive amplification with the presence of sea gene in all 5 isolates loading arrangement (1-5 represent different strains of S. aureus).Figure 2 shows agarose gel electrophoresis of the PCR product of seb gene in two S. aureus (Band size approximately 478 bp).Table 5 revealed the occurrence of enterotoxin producing S. aureus. The use of DNA hybridization and PCR approaches are reliable biological methods to detect staphylococcal enterotoxins using gene-specific nucleotide sequences as probes (Wu et al., 2016). In this study there was a low prevalence of enterotoxin producing S. aureus isolated from meats from chicken, turkey and fish. Findings ofAli (2014) andArslan and Özdemir (2017) revealed the presence of enterotoxin genes in S. aureus isolated from fish. S. aureus 18/31 (58.1%) isolated from raw lamb and beef meat were positive for the presence of at least one or more SE genes, while no SE genes were found in strains isolated from cooked meat (Haghi et al., 2021). Findings ofŞanlıbaba (2022) indicated sea and seb in S. aureus isolated from retail raw beef, sheep, and lamb meat in Turkey, which were directly connected to the contamination arose from human and animal origins. Findings of Rodríguez-Lázaro et al. (2017) examined 868 animal-derived food items; diverse meat from antelope, duck, guinea pig, pork, rodents, turkey, dairy products and eggs that were confiscated from the non- European Union passengers or illegally sold in an open market near an European Union border. The researchers revealed the presence of MRSA isolates with 73% tested positive for one or more enterotoxin genes A, B, C, D, G, H, I, and J. Kitai el. (2005) revealed that 78 enterotoxigenic S. aureus isolated from raw chicken meat; thighs, breasts, wings, livers, gizzards, hearts and ovaries belong to human biotype and poultry. SEs producing S. aureus are widely distributed in animals and humans and are frequently contaminating muscle foods leading to make Staphylococcal food poison, thereby causing a serious threat to consumers when bacteria multiply and release toxins in uncooked or inadequately cooked foods (Grispoldi et al., 2021).

Table 4 Resistance profile (%) of S. aureus isolated from selected frozen muscle Foods in Akure
AntibioticsChickenTurkeyT. trachurusS. scombrusM. merluccious
n=38n=51n=20n=3n=13
Rifampin20(52.60)33(64.70)13(65.00)1(33.30)7(53.80)
Gentamycin28(73.70)40(78.40)10(50.00)06(46.20)
Ampicillin16(42.1020(39.20)8(40.00)05(38.50)
Nitrofurantoin25(65.80)31(60.80)11(55.00)08(61.50)
Amoxicillin16(40.10)42(82.40)17(85.00)2(66.70)7(53.80)
Oxacillin30(78.90)37(72.50)10(50.00)3(100)4(30.70)
Fluoroquinolones18(47.40)32(62.75)8(40.00)3(100)4(30.70)
Streptomycin20(52.60)29(56.90)15(75.00)08(61.50)
Vancomycin14(36.80)18(35.30)5(25.00)1(33.30)4(30.70)
Erythromycin21(55.30)30(58.80)14(70.00)2(66.70)6(46.20)
Trimethoprim/sulfamethoxazole18(47.40)28(54.90)8(40.00)3(100)6(46.20)
n= number of S. aureus isolates. Values in bracket represent % resistance to antibiotics.
Figure 1 PCR amplification for the detection of sea gene in S. aureus. Lane M: 100 bp marker. Lanes 1-5 indicate sea gene (120 bp).
CJFST_15(1)_96-104-f1
Figure 2 PCR amplification for the detection of seb gene in S. aureus. Lane M: 100 bp marker. Lanes 3 and 5 indicate seb gene (478 bp).
CJFST_15(1)_96-104-f2
Table 5 Occurrence and antibiotic profile of enterotoxin producing S. aureus isolated from frozen meat and fish
Sample locationMuscle foodsAntibiotic resistance profileStaphylococcal
genes
Kings’ marketTurkeyGEN, AMP, STR, VAN, AMX, OXA, FLU, ERYsea
FUTA South GateTurkeyRFM, GEN, AMP, VAN, AMX, OXA, FLUsea
Kings’ marketChickenRFM, AMP, VAN, AMX, VAN, FLU, ERY, TMSsea
FUTA South GateChickenGEN, AMP, VAN, AMX, NIT, OXA, FLU, ERYsea
Isinkan MarketChickenRFM, VAN, AMX, STR, VAN, FLU, ERY, TMSsea
Araromi MarketChickenRFM, AMP, VAN, AMX, NIT, OXA, VAN, FLU, ERY, TMSseb
FUTA South GateT. trachurusGEN, AMP, STR, VAN, NIT, AMX, OXA, FLU, ERYseb
RFM: Rifampin, GEN: Gentamycin, AMP: Ampicillin, NIT: Nitrofurantoin, AMX: Amoxicillin OXA: Oxacillin, FLU: Fluoroquinolones, STR: Streptomycin, VAN: Vancomycin, ERY: Erythromycin, TMS: Trimethoprim/sulfamethoxazole

Conclusion

4.

The isolation and identification of S. aureus from selected muscle foods could be due to various types of contamination during processing steps and poor personnel hygiene of the food handlers. The low prevalence of enterotoxin producing S. aureus from frozen meat and fish can still be considered as a potential source of foodborne diseases. In order to safeguard public health, public enlightenment should be sustained to raise awareness on the proper cooking, packaging and storage of poultry products. The illegal importation of poultry products should be curbed by the creation of right policies and implementation of existing laws. The elimination of plethora pathogenic bacteria from frozen foods should be emphasized. With the increase in the prevalence of antibiotic resistant bacteria in frozen foods, public health awareness is essential as a preventative measure to control the use of antibiotics in livestock production.

Notes

[1] Financial disclosure Funding: “This research received no external funding”

[2] Conflicts of interest Conflicts of Interest: “The authors declare no conflict of interest.”

6. Literature

 

Abdalrahman LS, Stanley A, Wells H, Fakhr MK. Isolation, Virulence, and Antimicrobial Resistance of Methicillin-Resistant Staphylococcus aureus (MRSA) and Methicillin Sensitive Staphylococcus aureus (MSSA) Strains from Oklahoma Retail Poultry Meats. Int J Environ Res Public Health. 2015;12(6):6148–61. https://doi.org/10.3390/ijerph120606148 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/26035662

 

Akkaya L, Kara VR, Yaman H. Enterotoxin production by Staphylococcus aureus (A, B, C, D) during the ripening of sucuk (Turkish dry fermented sausage). CYTA J Food. 2014;12(2):127–33. https://doi.org/10.1080/19476337.2013.804124

 

Alegbeleye OO, Singleton I, Sant’Ana AS. Sources and contamination routes of microbial pathogens to fresh produce during field cultivation: A review. Food Microbiol. 2018;73:177–208. https://doi.org/10.1016/j.fm.2018.01.003 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/29526204

 

Ali HH. Isolation and identification of Staphylococcus bacteria from fish of fresh water and its antibiotics sensitivity in Mosul city. Basrah J Vete Res. 2014;13(1):33–42. https://doi.org/10.33762/bvetr.2014.88123

 

Archer DL. Freezing: an underutilized food safety technology? Int J Food Microbiol. 2004;90(2):127–38. https://doi.org/10.1016/S0168-1605(03)00215-0 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/14698095

 

Argudín MÁ, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel). 2010;2(7):1751–73. https://doi.org/10.3390/toxins2071751 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22069659

 

Arslan S, Özdemir F. Molecular characterization and detection of enterotoxins, methicillin resistance genes and antimicrobial resistance of Staphylococcus aureus from fish and ground beef. Pol J Vet Sci. 2017;20(1):85–94. https://doi.org/10.1515/pjvs-2017-0012 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28525337

 

Atanassova V, Meindl A, Ring C. Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham—a comparison of classical culturing detection and RFLP-PCR. Int J Food Microbiol. 2001;68:105–13. https://doi.org/10.1016/S0168-1605(01)00479-2 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11545209

 

Banerjee R, Maheswarappa NB. Superchilling of muscle foods: Potential alternative for chilling and freezing. Crit Rev Food Sci Nutr. 2019;59(8):1256–63. https://doi.org/10.1080/10408398.2017.1401975 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/29206051

 

Bodunde RS, Ogidi CO, Akinyele BJ. Load and antibiotic susceptibility pattern of microorganisms in muscle foods sold in Akure, Southwest Nigeria. J Food Qual Hazards Control. 2019;6:30–6. https://doi.org/10.18502/jfqhc.6.1.456

 

Cheesbrough M. (2006). District Laboratory Practice in Tropical Countries. 2nd Edition., Cambridge University Press, Cambridge, UK.

 

CLSI-Clinical Laboratory Standards Institute (2017): Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. CLSI document M100-S24 Wayne, Pennsylvania, 19087, USA.

 

Fawole MO, Oso BA. (2004): Characterization of bacteria: Laboratory Manual of Microbiology. 4th Edition, Spectrum Book Ltd., Ibadan, Nigeria, 24-33.

 

Grispoldi L, Karama M, Armani A, Hadjicharalambous C, Cenci-Goga BT. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital J Anim Sci. 2021;20(1):677–90. https://doi.org/10.1080/1828051X.2020.1871428

 

Haghi F, Zeighami H, Hajiloo Z, Torabi N, Derakhshan S. High frequency of enterotoxin encoding genes of Staphylococcus aureus isolated from food and clinical samples. J Health Popul Nutr. 2021;40(1):27. https://doi.org/10.1186/s41043-021-00246-x PubMed: http://www.ncbi.nlm.nih.gov/pubmed/34108048

 

Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol. 1991;29(3):426–30. https://doi.org/10.1128/jcm.29.3.426-430.1991 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/2037659

 

Kitai S, Shimizu A, Kawano J, Sato E, Nakano C, Kitagawa H, et al. Prevalence and characterization of Staphylococcus aureus and enterotoxigenic Staphylococcus aureus in retail raw chicken meat throughout Japan. J Vet Med Sci. 2005;67(3):269–74. https://doi.org/10.1292/jvms.67.269 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15805729

 

Krieg NR, Staley JT, Brown DR, Hedlund BP, Paster BJ, Ward NL, et al. (2010): The Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, Gemmatimona detes, Lentisphaerae, Verrucomicrobia, Chlamydiae, and Planctomycetes, 2nd ed., vol. 4. New York: Springer. https://doi.org/ https://doi.org/10.1007/978-0387-68572-4.

 

Kumar H, Bhardwaj K, Kaur T, Nepovimova E, Kuča K, Kumar V, et al. Detection of bacterial pathogens and antibiotic residues in chicken meat: a review. Foods. 2020;9(10):1504. https://doi.org/10.3390/foods9101504 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/33092226

 

Laskowski W, Górska-Warsewicz H, Kulykovets O. Meat, meat products and seafood as sources of energy and nutrients in the average Polish diet. Nutrients. 2018;10(10):1412. https://doi.org/10.3390/nu10101412 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30279395

 

Lozano C, Gharsa H, Ben Slama K, Zarazaga M, Torres C. Staphylococcus aureus in animals and food: methicillin resistance, prevalence and population structure. A review in the African continent. Microorganisms. 2016;4(1):12. https://doi.org/10.3390/microorganisms4010012 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/27681906

 

Namir IM, Mohammad JA. Isolation and Identification of Staphylococcus aureus strains from fresh and frozen meat in Karbala Province. Int J Sci Nat. 2017;8(3):704–9.

 

Ogidi CO, Oyetayo VO, Akinyele BJ. Microbial quality and antibiotic sensitivity profile of microorganisms isolated from street foods sold in Akure metropolis, Nigeria. Jordan J Biol Sci. 2016;9(4):227–34.

 

Ogofure AG, Igbinosa EO. Effects of rinsing on Staphylococcus aureus load in frozen meats and fish obtained from open markets in Benin City, Nigeria. Afr J Clin Exp Microbiol. 2021;22(2):294–9. https://doi.org/10.4314/ajcem.v22i2.24

 

Olutiola PO, Famurewa O, Sonntag HG. (2000): An introduction to general microbiology. A practical approach, 1st ed. Heidelberger Verlagsanstalt, Heidelberg, Germany.

 

Oranusi S, Obioha TU, Adekeye BT. Investigation on the microbial profile of frozen foods: Fish and Meat, Int. J Adv Res Biol Sci. 2014;1(2):71–8.

 

Ortega E, Abriouel H, Lucas R, Gálvez A. Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins (Basel). 2010;2(8):2117–31. https://doi.org/10.3390/toxins2082117 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22069676

 

Park S, Ronholm J. Staphylococcus aureus in agriculture: lessons in evolution from a multispecies pathogen. Clin Microbiol Rev. 2021;34(2):e00182–20. https://doi.org/10.1128/CMR.00182-20 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/33568553

 

Parvin MS, Ali, Md. Y., Talukder, S., Nahar, A., Chowdhury, E. H., Rahman, Md. T., Islam, Md. T. Prevalence and multidrug resistance pattern of methicillin resistant s. aureus isolated from frozen chicken meat in Bangladesh. Microorganisms. 2021;9(3):636. https://doi.org/10.3390/microorganisms9030636 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/33803779

 

Pepe O, Blaiotta G, Bucci F, Anastasio M, Aponte M, Villani F. Staphylococcus aureus and staphylococcal enterotoxin A in breaded chicken products: detection and behavior during the cooking process. Appl Environ Microbiol. 2006;72(11):7057–62. https://doi.org/10.1128/AEM.00198-06 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17088378

 

Pinchuk IV, Beswick EJ, Reyes VE. Staphylococcal enterotoxins. Toxins (Basel). 2010;2:2177–97. https://doi.org/10.3390/toxins2082177 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22069679

 

Şanlıbaba P. Prevalence, antibiotic resistance, and enterotoxin production of Staphylococcus aureus isolated from retail raw beef, sheep, and lamb meat in Turkey. Int J Food Microbiol. 2022;361:109461. https://doi.org/10.1016/j.ijfoodmicro.2021.109461 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/34742144

 

Savariraj WR, Ravindran NB, Kannan P, Rao VA. Occurrence and enterotoxin gene profiles of Staphylococcus aureus isolated from retail chicken meat. Food Sci Technol Int. 2021;27(7):619–25. https://doi.org/10.1177/1082013220980204 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/33307778

 

Sergelidis D, Abrahim A, Papadopoulos T, Soultos N, Martziou E, Koulourida V, et al. Isolation of methicillin- resistant Staphylococcus spp. from ready-to-eat fish products. Lett Appl Microbiol. 2014;59(5):500–6. https://doi.org/10.1111/lam.12304 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/25059796

 

Suo B, Yang H, Wang Y, Lv H, Li Z, Xu C, et al. Comparative proteomic and morphological change analyses of Staphylococcus aureus during resuscitation from prolonged freezing. Front Microbiol. 2018;9:866. https://doi.org/10.3389/fmicb.2018.00866 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/29774015

 

Tam K, Torres VJ. Staphylococcus aureus secreted toxins and extracellular enzymes. Microbiol Spectr. 2019;7(2): https://doi.org/10.1128/microbiolspec.GPP3-0039-2018 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30873936

 

Thwala T, Madoroba E, Basson A, Butaye P. Prevalence and characteristics of staphylococcus aureus associated with meat and meat products in African Countries: A review. Antibiotics (Basel). 2021;10(9):1108. https://doi.org/10.3390/antibiotics10091108 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/34572690

 

Varshney AK, Mediavilla JR, Robiou N, Guh A, Wang X, Gialanella P, et al. Diverse enterotoxin gene profiles among clonal complexes of Staphylococcus aureus isolates from the Bronx, New York. Appl Environ Microbiol. 2009;75:6839–49. https://doi.org/10.1128/AEM.00272-09 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19749060

 

Wang W, Baloch Z, Jiang T, Zhang C, Peng Z, Li F, et al. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China. Front Microbiol. 2017;8:2256. https://doi.org/10.3389/fmicb.2017.02256 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/29209290

 

Wu S, Duan N, Gu H, Hao L, Ye H, Gong W, et al. A Review of the methods for detection of Staphylococcus aureus enterotoxins. Toxins (Basel). 2016;8(7):176. https://doi.org/10.3390/toxins8070176 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/27348003

 

Wu S, Huang J, Wu Q, Zhang J, Zhang F, Yang X, et al. Staphylococcus aureus isolated from retail meat and meat products in China: incidence, antibiotic resistance and genetic diversity. Front Microbiol. 2018;9:2767. https://doi.org/10.3389/fmicb.2018.02767 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/30498486

 

Zhan X, Sun DW, Zhu Z, Wang QJ. Improving the quality and safety of frozen muscle foods by emerging freezing technologies: A review. Crit Rev Food Sci Nutr. 2018;58(17):2925–38. https://doi.org/10.1080/10408398.2017.1345854 PubMed: http://www.ncbi.nlm.nih.gov/pubmed/28723226


This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.