Introduction
1.
Frozen meat, fish, poultry and sea foods are important source of proteins in diets and mostly consumed by people of all social strata (Laskowski et al., 2018). Tissues from healthy animals are sterile, but many factors can influence their microbial contamination during slaughtering. Microbial contamination is possible through the water, air, soil, from the workers andthe equipment involved and it often leads to spoilage if not properly handled, processed and preserved (Alegbeleye et al., 2018). The most common method to preserve muscle foods is by chilling and freezing, while super-chilling is also an attractive technique of preserving muscle foods to maintain their freshness, enhancing the shelf-life during storage, transportation and at retail (Banerjee and Maheswarappa, 2019). Freezing preserves muscle foods for extended periods by suppressing the growth and multiplication of microorganisms that could cause food spoilage and foodborne illnesses (Archer, 2004;Zhan et al., 2018). In frozen products, some microorganisms are killed, while others might only be sub-lethally damaged and can recover upon thawing if storage is above -10 °C. Gram negative bacteria are more susceptible to freezing injury than Gram positive bacteria. Hence, it supports the occurrence of Staphylococcus species in frozen meats and fish (Ogofure and Igbinosa, 2021).
S. aureus is a Gram-positive bacteria and facultative anaerobe, which can live as a commensal organism on the skin as well as mucosal membranes. S. aureus recovers and survives sub-lethalinjuries from freezing with cell membrane synthesis-related proteins, oxidative stress resistance-related proteins, and metabolism-related proteins with their virulence factors exhibit distinct expression patterns during resuscitation (Suo et al., 2018). The resuscitation mechanisms adopted by S. aureus together with their multiple antibiotic resistance pose a threat to food safety and are now of public health concern.
The multiple resistance of S. aureus to all β -lactam antibiotics has been linked to the presence of an enzyme; β-lactamase and the mecA gene that encode penicillin-binding protein (PBP2a), which allows the synthesis of the cell wall even at lethal concentrations of β –lactam antibiotics (Atanassova et al., 2017). S. aureus produces a variety of enzymes, toxins (cytotoxins, exotoxins, and exfoliative) with multiple virulence factors encoded by phages, plasmids, and pathogenicity, which has the ability to bind the major histocompatibility complex proteins of their host’s immune system (Tam and Torres, 2019). Staphylococcal food poisoning is an intoxication that occurrs after consuming improperly prepared foods contaminated with S. aureus enterotoxins as a result of unhygienic practices including improper handling of cooked or processed muscles foods, followed by their storage conditions (Argudín et al., 2010). S. aureus is a major cause of food poisoning induced by heat resistant enterotoxin and is one of the leading causes of foodborne illnesses (Varshney et al., 2009;Pinchuk et al., 2010). S. aureus strains produce a large variety of enterotoxins A, B, C, and D that have been frequently detected in poultry meat products (Pepe et al., 2006;Akkaya et al., 2014). Enterotoxin S. aureus is considered to be the most common pathogen causing outbreaks of food poisoning, characterized by symptoms associated with gastroenteritis, including vomiting, nausea, abdominal pain, cramps, diarrhea and causing significant morbidity (Ortega et al., 2010). The contamination of foods with pathogenic microorganisms with reoccurrence of foodborne diseases face significant challenges in modern healthcare services and have substantial negative impacts on economy. Enterotoxins are primarily responsible for foodborne illnesses and morbidity. Hence, frequent screening of staphylococcal enterotoxins (SE) in commonly consumed foods like animal muscle foods, poultry foods, and dairy products is paramount since they are foods of proteins source. This study, therefore, investigated the antibiotics sensitivity patterns and occurrence of enterotoxins S. aureus in selected frozen poultry meat (frozen chicken and turkey) and fish like Scomber scrombus, Trachurus trachurus and Merluccious merluccious vended in Akure metropolis.
Materials and methods
2.
Collection of meat and fish
Samples of frozen meat of chicken (Gallus gallus domesticus) = 130, turkey (Meleagris gallopavo domesticus) = 130, and different fish species, namely, horse mackerel (Trachurus trachurus) = 80, mackerel (Scomber scrombrus) = 80, and hake (Merluccius merluccius) = 80, were randomly purchased at different vendors in Akure. Samples were collected in ice packs and transported to Postgraduate Research Laboratory, Department of Microbiology, The Federal University of Technology, Akure, for microbiological analysis.
Isolation and identification of Staphylococcus aureus
One gram of tissue from each sample was crushed in sterile crucible and serially diluted to ten-fold dilutions, each dilution (104) was plated on mannitol salt agar using pour plate method and incubated at 37 oC for 24 hours. The colonies were counted using colony counter (TT-20, Techmel and Techmel, USA). The colony was sub-cultured to obtain pure isolate. The morphological, Gram’s reaction and biochemical tests like catalase, coagulase, oxidase, methyl red, Voges Proskauer, and sugar fermentation were carried out according to methods ofOlutiola et al. (2000) andCheesbrough (2006). The identity of isolates was determined based on the biochemical reactions usingKrieg et al. (2010).
Antibiotic susceptibility of Staphylococcus
The modified Kirby-Bauer method was used to determine the susceptibility of obtained isolates to some antibiotics as described by The Clinical and Laboratory Standards Institute (CLSI, 2017). The inoculum size in nutrient broth (18 h old culture) was adjusted to 0.5 McFarland turbidity standards to 1.3 × 105 CFU/ml. Thereafter, 0.1 ml of the suspension was transferred to prepared Mueller-Hinton agar and spread with a sterilized glass spreader. The surface of the agar was allowed to dry, antibiotic discs were placed at the equidistance of the plate by sterile forceps and aseptically placed on top of agar plate. The plates were incubated at 37 oC for 18 hours. After incubation, a clear zone of no growth in the immediate vicinity of antibiotic disk was measured and recorded as diameter of zone of inhibition in millimeter (mm), interpreted using CLSI interpretative chat as resistance, intermediate and susceptible (CLSI, 2017).
Genomic DNA extraction and PCR test for staphylococcal enterotoxin genes
S. aureus isolates were further examined for the presence of enterotoxin genes using specific primer in a multiplex PCR assay. DNA of S. aureus was extracted with PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific, USA) according to manufacturer’s instructions. The primers used for the detection of SE genes are listed inTable 1 (Johnson et al., 1991). For polymerase chain reaction amplification, the reaction mixture contained: 2.5 µl 10 X PCR buffer (Invitrogen), 1 µl DNA, 1 µl of primer F (10 pmol), 1 µl of primer R (10 pmol), 0.5 µl dNTP (10 mM, Invitrogen), 1.5 µl MgCl2 (Invitrogen), 0.5 U Taq DNA polymerase (Invitrogen) and final volume was adjusted to 25 µl by adding sterile ultrapure water. DNA amplification was performed in a thermal cycler with initial denaturation at 94 °C for 5 min followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. The amplified PCR products were electrophoresed in a 1.5% agarose gel (Sigma–Aldrich) containing 0.5 mg/ml ethidium bromide, TBE buffer (0.09 M Tris–HCl, 0.09 M boric acid, 2 mM EDTA, pH 8.3) for 30 min at 100 V and visualized under UV trans-illumination.
| Gene | Primers | Sequences5’-3’ | Gene location | Size (bp) of PCR product |
|---|---|---|---|---|
| sea | SEA-F | ttggaaacggttaaaacgaa | 490-509 | |
| SEA-R | gaaccttcccatcaaaaaca | 591-610 | 120 | |
| seb | SEB-F | tcgcatcaaactgacaaacg | 634-653 | |
| SEB-R | gcaggtactctataagtgcc | 1091-1110 | 478 | |
| Source: (Johnson et al., 1991) | ||||
Results and discussion
3.
Table 2 shows total Staphylococcal count (×105 CFU/g) of frozen muscle foods. The staphylococcal count of 0.70 to 7.50 × 105 CFU/g were obtained for meat from chicken, 1.50 to 7.40 × 105 CFU/g, 2.10 to 7.70 ×105 CFU/g, 3.30 to 5.10 × 105 CFU/g and 1.00 to 6.50 ×105 CFU/g were recorded for turkey meat, T. trachurus, S. scombrus and M. merluccious, respectively. Findings ofBodunde et al. (2019) reported Staphylococcus count of 1.70×104 to 6.0×105 CFU/g for different muscle foods like beef (Bos taurus), chicken (Gallus gallus domesticus), turkey (Meleagris gallopavo), pork (Sus scrofa domesticus), chevon (Capra aegagrus hircus), mackerel (Scomber scombrus), horse mackerel (Trachurus trachurus), herrings (Clupea pallasii), blue whiting (Merluccius merluccius), and croaker (Micropogonias undulatus). The higher S. aureus count in meat and fish is a result of improper hygienic practices at the point of handling by slaughter personnel during meat production. Findings ofThwala et al. (2021) reported that a total of 2853 samples containing beef, pork, goat meat, camel meat, sheep/lamb from different African countries were highly contaminated with higher load of S. aureus. Species of Staphylococcus like S. aureus, S. epidermidis, S. xylosus, . sciuri, S. warneri, S. saprophyticus, S. schleiferi and S. auricularis were identified from ready-to-eat fish products (Sergelidis et al. 2014). Humans and animals such as cattle, pigs, chickens, turkey, horses, and sheep can be colonised by S. aureus on their skin and in their nares (Lozano et al., 2016). The frequency of Staphylococci in muscle foods (meat and fish) is revealing how commensal bacteria from human skin and mucosal surfaces contributed to the contamination during different stages of processing; slaughtering, transportation, chopping, storage and persons involved in the marketing (Wu et al., 2018).Table 3 reveals the occurrence of S. aureus in selected frozen muscle foods, meat from chicken, turkey and fish. Frozen meat of turkey has got the highest occurrence of S. aureus 40.80%, followed by meat of chicken with 30.40%, but S. scombrus has got the least occurrence of 2.40%. Findings ofOgofure and Igbinosa (2021) showed that beef had the highest frequency of S. aureus contamination (46.7%), followed by chicken (40.0%) and fish (30.0%).Wu et al. (2018) also reported 35% of S. aureus from 1,850 samples of frozen meat and meat products sold in 39 cities and provincial capitals of China.Savariraj et al. (2021) isolated 66.67% of S. aureus from 120 chicken meat marketed in retail outlets of Chennai, India.
Higher prevalence of S. aureus (64%) has been reported from frozen meat and fresh meat from Karbala province in Iraq (Namir et al., 2017). Likewise,Oranusi et al. (2014);Ogidi et al. (2016); andBodunde et al. (2019) reported the prevalence of S. aureus in muscle foods and ready-to- eat foods examined in Nigeria. The prevalence of S. aureus could be attributed to poor hygienic practice of personnel, equipment in slaughterhouses, salesmen and women.Table 4 shows the resistance percentage of S. aureus isolates to rifampin, gentamycin, ampicillin, nitrofurantoin, amoxicillin, oxacillin, fluoroquinolones, streptomycin, vancomycin, erythromycin and trimethoprim/sulfamethoxazole. The resistance percent ranged from 33.3 to 100%. Findings of Parvin et al. (2021) revealed the highest resistance percentage of 73.9% to 100% for S. aureus isolated from frozen chicken meat against cefoxitin, nalidixic acid, ampicillin and oxacillin, colistin, amoxicillin-clavulanic acid and amoxicillin, penicillin-G and cloxacillin, oxytetracycline, and cefixime. Findings ofWang et al. (2017) revealed a total of 1,150 S. aureus isolated from 27,000 retail foods with 97.6% of S. aureus dispalyed resistant to at least one antimicrobial compound like penicillin, oxacillin, cefoxitin, vancomycin, daptomycin, erythromycin, gentamicin, tetracycline, ciprofloxacin, clindamycin, trimethoprim-sulfamethoxazole, chloramphenicol, linezolid and 57.5% of these were multi drug resistant. S. aureus isolated from frozen meat and fish were highly resistant to some of the commercially available antibiotics (Ogofure and Igbinosa, 2021). The researchers reported the antibiotic resistance profile of S. aureus with high resistance to erythromycin (94%), amoxicillin/clavulanic acid (87.5%) and trime- thoprim-sulfamethoxazole (81%). Findings ofWu et al. (2018) revealed that S. aureus isolated from 1,850 retail meat and meat products displayed resistance of 11.0% to 85.4% to ampicillin, penicillin, erythromycin, tetracycline, kanamycin, telithromycin, clindamycin, streptomycin, norfloxacin, gentamicin, fusidic acid, ciprofloxacin, chloramphenicol, amoxycillin/clavulanic acid. S. aureus isolated from Oklahoma retail chicken and turkey meats displayed multiple resistance (5.4 to 94.6%) to ampicillin, tetracycline, penicillin, doxycycline, oxacillin, azithromycin, erythromycin, vancomycin, ciprofloxacin, cefoxitin, gentamicin, kanamycin, clindamycin, rifampin, trimethoprim/sulfamethazole, chloramphenicol with 12 Methicillin-Resistant S. aureus (MRSA) showed 100% resistance to ampicillin, penicillin, cefoxitin with 2% NaCl, oxacillin with 2% NaCl, azithromycin, and erythromycin (Abdalrahman et al., 2015). The use of medically important antibiotics in livestock production is tremendously contributing to multiple antibiotic resistance and pathogenicity of S. aureus (Park and Ronholm, 2021). The ability of various pathogenic bacteria to withstand antibiotic residues in muscle foods contributed to reoccurrence emergency of foodborne diseases, which have become a matter of food security worldwide (Kumar et al., 2020).Figure 1 shows agarose gel electrophoresis of the PCR product of sea gene in selected bacteria isolates (120 bp). Gel image indicates a positive amplification with the presence of sea gene in all 5 isolates loading arrangement (1-5 represent different strains of S. aureus).Figure 2 shows agarose gel electrophoresis of the PCR product of seb gene in two S. aureus (Band size approximately 478 bp).Table 5 revealed the occurrence of enterotoxin producing S. aureus. The use of DNA hybridization and PCR approaches are reliable biological methods to detect staphylococcal enterotoxins using gene-specific nucleotide sequences as probes (Wu et al., 2016). In this study there was a low prevalence of enterotoxin producing S. aureus isolated from meats from chicken, turkey and fish. Findings ofAli (2014) andArslan and Özdemir (2017) revealed the presence of enterotoxin genes in S. aureus isolated from fish. S. aureus 18/31 (58.1%) isolated from raw lamb and beef meat were positive for the presence of at least one or more SE genes, while no SE genes were found in strains isolated from cooked meat (Haghi et al., 2021). Findings ofŞanlıbaba (2022) indicated sea and seb in S. aureus isolated from retail raw beef, sheep, and lamb meat in Turkey, which were directly connected to the contamination arose from human and animal origins. Findings of Rodríguez-Lázaro et al. (2017) examined 868 animal-derived food items; diverse meat from antelope, duck, guinea pig, pork, rodents, turkey, dairy products and eggs that were confiscated from the non- European Union passengers or illegally sold in an open market near an European Union border. The researchers revealed the presence of MRSA isolates with 73% tested positive for one or more enterotoxin genes A, B, C, D, G, H, I, and J. Kitai el. (2005) revealed that 78 enterotoxigenic S. aureus isolated from raw chicken meat; thighs, breasts, wings, livers, gizzards, hearts and ovaries belong to human biotype and poultry. SEs producing S. aureus are widely distributed in animals and humans and are frequently contaminating muscle foods leading to make Staphylococcal food poison, thereby causing a serious threat to consumers when bacteria multiply and release toxins in uncooked or inadequately cooked foods (Grispoldi et al., 2021).
_96-104-f1.jpg)
_96-104-f2.jpg)
Conclusion
4.
The isolation and identification of S. aureus from selected muscle foods could be due to various types of contamination during processing steps and poor personnel hygiene of the food handlers. The low prevalence of enterotoxin producing S. aureus from frozen meat and fish can still be considered as a potential source of foodborne diseases. In order to safeguard public health, public enlightenment should be sustained to raise awareness on the proper cooking, packaging and storage of poultry products. The illegal importation of poultry products should be curbed by the creation of right policies and implementation of existing laws. The elimination of plethora pathogenic bacteria from frozen foods should be emphasized. With the increase in the prevalence of antibiotic resistant bacteria in frozen foods, public health awareness is essential as a preventative measure to control the use of antibiotics in livestock production.